Bruksanvisning för CRC RAScan™ Combination Kit

advertisement
1 Tillverkare
Bruksanvisning för
CRC RAScan™ Combination Kit
A SURVEYOR® Scan KRAS och NRAS Kit
Exons 2, 3 & 4 CE IVD
med DHPLC-system
Läs dessa anvisningar noga innan du använder produkten.
Spara denna bruksanvisning för framtida bruk.
Denna sida har avsiktligt lämnats tom
Innehållsförteckning
1 Tillverkare ..................................................................................................................... 3 2 CRC RAScan™ Combination Kit ................................................................................. 3 2.1 Avsedd användning ............................................................................................................. 3 2.2 Indikationer ......................................................................................................................... 3 3 Principer för CRC RAScan KRAS och NRAS mutationsdetektionsanalys .............. 4 3.1 KRAS och NRAS .................................................................................................................... 4 3.2 Analys av patientprover med SURVEYOR Scan Kit ............................................................... 4 3.3 SURVEYOR Nuclease ............................................................................................................ 5 4 Härledning av kittets kontrollsubstanser ................................................................... 6 5 Komponenter ................................................................................................................ 7 5.1 Låda med SURVEYOR Scan KRAS Kit Exons 2, 3 & 4 (h 710107) ........................................ 7 5.2 Låda med SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 (h 710400) ........................................ 8 5.3 Antal prover som kan testas med ett kit .............................................................................. 8 5.4 DNA‐sekvensering ............................................................................................................... 9 6 Ytterligare nödvändig utrustning och reagenser ....................................................... 9 7 Reagensberedning ....................................................................................................... 9 8 Förvaring och hållbarhet ........................................................................................... 10 9 Varningar och försiktighetsåtgärder......................................................................... 10 10. Förberedande provinsamling, hantering och förvaring ....................................... 10 11 Analysprocess .......................................................................................................... 11 11.1 Somatisk mutationsdetektion med SURVEYOR Scan‐kit ‐ En översikt .............................. 11 12 Stegvisa anvisningar ............................................................................................... 12 12.1 INLEDANDE installation/kalibrering av DHPLC ............................................................. 12 12.2 Att tänka på före KRAS‐ och NRAS‐provanalys ................................................................. 12 12.3 Att tänka på avseende templat ........................................................................................ 12 12.4 Att tänka på avseende arbetsflödet ................................................................................. 12 12.5 Amplifieringsprotokoll ..................................................................................................... 15 12.6. Termocykelprogram för amplifieringsprotokoll .............................................................. 17 12.7 Kvalitetskontroll av PCR‐produkter .................................................................................. 17 12.8 SURVEYOR Nuclease‐nedbrytning ................................................................................... 18 13 Kontrollparametrar ................................................................................................... 20 13.1 Kvalitetskontroll av CRC RAScan Combination Kit ............................................................ 20 13.2 Användning av kontrollplasmid‐DNA ............................................................................... 20 14 Tolkning av resultat ................................................................................................. 21 14.1 Analys av KRAS och NRAS Exons 2, 3 och 4 med SURVEYOR Nuclease ............................. 21 14.2 Granskning av SURVEYOR Scan‐resultat .......................................................................... 21 14.3 Exempel på resultat ......................................................................................................... 22 15 Prestationsegenskaper ............................................................................................ 29 15.1 LOD för mutationer med SURVEYOR Scan‐kit .................................................................. 29 15.2 Sekvensbekräftelse .......................................................................................................... 29 15.3 Analysprocessens begränsningar ..................................................................................... 30 Bilaga A.......................................................................................................................... 31 A.1 Översikt av platta för SURVEYOR Scan kit .......................................................................... 31 A.2 Kontrollernas DNA‐stämplar ............................................................................................. 31 A.3 Systemkrav för denaturering med HPLC (DHPLC) .............................................................. 32 A.4 Laboratorieinstallation för PCR‐analyser ........................................................................... 33 A.5 Litteraturlista .................................................................................................................... 35 Bilaga B.......................................................................................................................... 36 Felsökningsguide ..................................................................................................................... 36 Beställningsinformation ............................................................................................... 43 Kontaktuppgifter ........................................................................................................... 43 Översättning Ansvarsfriskrivning ................................................................................ 43 Varumärken & upphovsrätt .......................................................................................... 44 1 Tillverkare
1 Tillverkare
M
Tillverkare
EGrepresentant
P
Transgenomic, Inc.
12325 Emmet Street, Omaha, NE 68164, USA
Tel +1-402-452-5400
Transgenomic Limited
40 Watt Road, Hillington Park, Glasgow G52 4RY, UK
Tel +44-141-892-8800
2 CRC RAScan™ Combination Kit
2.1 Avsedd användning
Endast för professionellt bruk. Transgenomics CRC RAScan Combination Kit är en in vitro
diagnostisk analys som upptäcker somatiska mutationer i Exon 2, 3 och 4 i KRAS- och NRASgenerna. Dessa mutationer påvisas av SURVEYOR Nuclease-klyvningstoppar och inkluderar de
mutationer som har känd potential för klinisk signifikans. Detta kit är utformat för användning i ett
kliniskt diagnostiskt laboratorium av utbildad personal som testar DNA som utvunnits ur
formalinfixerad paraffininbäddad vävnad.
Detta kit har referensen katalognummer 710077. Denna bruksanvisning kan hämtas på
http://world.transgenomic.com/files/literature/482427-SV.pdf.
2.2 Indikationer
Kliniker kan använda CRC RAScan Combination Kit med DHPLC-system för att underlätta
fastställande om patienters kolorektala cancer kanske inte kommer att svara på behandling med
EGFR-hämmare (epidermal growth factor receptor) såsom panitumumab.
CRC RAScan Combination Kit får inte användas för diagnos av kolorektal cancer eller någon
annan form av cancer.
CRC RAScan Combination Kit är en analys som detekterar förekomsten av potentiella somatiska
mutationer i Exons 2, 3 och 4 hos KRAS-genen, men som inte bekräftar mutationens
sekvensidentitet. För att bestämma exakt vilken mutation som detekteras krävs ytterligare
analys, t.ex. DNA-sekvensering.
Analysresultaten med detta kit kommer visserligen att visa patientens mutationsstatus, men andra
kliniska faktorer bör beaktas. Resultat som erhålls mned CRC RAScan Combination Kitbör inte
vara den enda metod som används för att besluta om behandling av patienter med
kolorektal cancer.
Det är viktigt att notera att användning av DHPLC för att identifiera prover som är positiva för en
KRAS- eller NRAS-mutation med detta kit endast bör utgöra en vägledning och att alla
mutationer måste bekräftas genom ytterligare analys, t.ex. DNA-sekvensering.
Bruksanvisning för CRC RAScan Kit med DHPLC-system
Sid. 3
3 Principer för CRC RAScan KRAS och NRAS mutationsdetektionsanalys
3 Principer för CRC RAScan KRAS och NRAS
mutationsdetektionsanalys
3.1 KRAS och NRAS
Riktade terapier för receptorn EGFR (epidermal growth factor receptor) har visat sig vara effektiva
mot kolorektalcancer. Forskning har visat att cirka 40 % av alla kolorektala tumörer bär på
somatiska KRAS-genmutationer och kliniska studier visade att mutationer i KRAS Exon 2 (kodon
12 och 13) förutspår bristande svar på EGFR-hämmande behandling. Nyligen genomförda
undersökande studier har visat att patientpopulationen kan sållas ytterligare eftersom inte heller
patienter vars mCRC-tumörer hade ytterligare en mutation i KRAS Exons 3 och 4 eller NRAS
Exons 2, 3 och 4 tenderade att svara på EGFR-hämmande behandlning1-7. Detta kit är utformat för
användning vid diagnostisk analys av somatiska mutationer i KRAS och NRAS Exons 2, 3 och 4.
CRC RAScan Combination Kit är en analys för detektion av alla sekvens- samt infogade/saknade
avvikelser i Exons 2, 3 och 4 hos KRAS- och NRAS-generna. Mutationer i KRAS och NRASkodon
12, 13, 59, 61, 117 och 146 har förknippats med bristande effekt hos panitumumab. Positive
Controls tillhandahålls i detta kit för mutationer i kodon 12, 61, 117 och 146.
Detta kit använder Transgenomics patentskyddade SURVEYOR Nuclease-teknik och ger, i
samverkan med DHPLC System teknik, en enkel och känslig detektion av potentiella mutationer.
Det kan detektera en blandning av 2-5 % muterat DNA i en bakgrund av ej muterat DNA.
Kontrollstudier har påvisat extremt hög överensstämmelse i väldefinierade prover med
kolorektalcancer. Användning av CRC RAScan Combination Kit kommer att minska användarens
sekvenseringbörda och även hjälpa till vid sekvenseringsbestämning då automatisk
sekvenseringsprogramvara inte klarar att klargöra förekomst av låg mutationsnivå.
På grund av att denna analys har en hög känslighet i förhållande till Sanger-sekvensering,
rekommenderas att laboratoriets installation är optimerad för att undvika korskontamination av
prover eller kontroller. Ett exempel på ett idealiskt laboratoriearrangemang finns i Bilaga A.4
Laboratorieinstallation för PCR-analyser.
3.2 Analys av patientprover med SURVEYOR Scan Kit
CRC RAScan Combination Kit får endast användas i samband med det arbetsflöde som visas
nedan.
Arbetsflöde
Patientprov
Test KRAS och NRAS
Exons 2, 3 & 4
Rapportera
resultat
Figur 1 CRC RAScan Combination Kit arbetsflöde för screening av KRAS och NRAS
För förslag på hur plattor med 96 brunnar kan arrangeras för analys av alla KRAS och NRAS
Exons 2-4, se Bilaga A.1 Översikt av platta för CRC RAScan Combination Kit.
Bruksanvisning för CRC RAScan Kit med DHPLC-system
Sid. 4
3 Principer för CRC RAScan Scan KRAS och NRAS mutationsdetektionsanalys
3.3 SURVEYOR Nuclease
Transgenomics SURVEYOR Nuclease är en avvikelsespecifik (mismatch-specific) växtbaserad
DNA-endonukleas som kan söka efter kända och okända mutationer och polymorfismer i
heteroduplex DNA8. Enzymet klyver DNA med hög precision på ställen med avvikelser i basen och
andra förändringar. Denna DNA-endonukleas klipper av båda strängarna på en DNA-heteroduplex
på 3’-sidan av det avvikande stället. Tillfogade/saknade och bassubstituerande avvikelser
identifieras men klyvningens effektivitet varierar beroende på sekvensen på avvikelsen.
Figur 2. Verkningssätt för
SURVEYOR Nuclease.
Endonukleasen känner igen en
avvikelse och klyvs vid 3’-sidan av
det avvikande stället. Detta klyver
den dubbla DNA-strängen och
lämnar kvar ett 3’-överhäng av ett
enda baspar.
SURVEYOR Nuclease har använts i många olika sammanhang för att korrekt detektera en rad
mutationer och polymorfismer i gener. I synnerhet har SURVEYOR Nuclease använts för att
bekräfta förekomsten av kända mutationer i ett antal gener som associeras med njurcancer,
lungcancer, cancer i huvud och nacke, leukemi, endometriecancer och för att förutsäga resultatet
av strålbehandling9,10,11.
CRC RAScan Combination Kit har utformats för att klyva avvikelser i KRAS och NRAS Exons 2, 3
och 4 för efterföljande analys av DHPLC.
Obs! Om ett prov är 100% muterat DNA, kan inga heterduplex bildas och provet kommer att
visas som "Wild-Type". Biopsiprover från tumörer kommer dock att innehålla Wild-Typeceller på grund av tumörheterogenitet och/eller kontamination av normala vävnader; notera
att prover med 5% och 95% muterat DNA kommer att ha identiska kromatogram.
Obs! Endast den DNA Polymerase som tillhandahålls med detta kit får användas för
analysens PCR-komponent.
Obs! Följ specifika anvisningar i handboken till ditt DHPLC-system.
För att framgångsrikt använda detta kit rekommenderar vi att du läser igenom den här
handboken och noggrant följer alla instruktioner och riktlinjer. Nya användare bör utföra de
kontrollexperiment som beskrivs i avsnittet Användning av kontroll-DNA-plasmider.
Om du har ytterligare frågor eller behöver hjälp kan du kontakta (888) 233-9283 (endast
Nordamerika), +1 (402) 452-5400 eller +44 (0) 141 892 8800 (Europa) och begära "KRAS- och
NRAS-support". Alternativt kan du mejla oss på:
[email protected]
Bruksanvisning för CRC RAScan Combination Kit med DHPLC-system
Sid. 5
4 Härledning av kittets kontrollsubstanser
4 Härledning av kittets kontrollsubstanser
De kontrollsubstanser som tillhandahålls i detta kit är plasmida kloner av KRAS och NRAS Exon 2,
3- och 4-sekvenser. Alla kloner har sekvenserats för att verifiera sekvensens överensstämmelse
genom jämförelse med NCBI Reference Seuquences: NG_007524.1 (KRAS) och NG_007572
(NRAS).
Kontrollerna har en genetisk "stämpel". Se Bilaga A.2 Kontrollernas DNA-stämplar; dessa är
variationer av KRAS eller NRAS Wild-Type-sekvenser i en region som inte förväntas ha
mutationer och som kan användas för att felsöka provkontamination av Positive Controls. Se
Bilaga B - Felsökningsguide, problem 8, för ett exempel på en SURVEYOR Scan-kurva av
sådan kontamination.
"KRAS Control Wild-Type" konstruerades genom syntes och kloning av KRAS Exons 2, 3 och 4
med användning av NCBI Reference Sequence NG_007524.1.
"KRAS Positive Control Exon 2" konstruerades genom syntes av KRAS Exon 2 med
användning av ovanstående referenssekvens, men innehållande G12D-mutationen. DNAsekvensering bekräftade att den enda förändringen i sekvensen är vid kodon 12 med en
GGT>GAT-förändring. Denna klon blandas därefter med KRAS Control Wild-Type-DNA för att
skapa en heterozygot blandning.
"KRAS Positive Control Exon 3" konstruerades genom syntes av KRAS Exon 3 med
användning av ovanstående referens, men innehållande Q61H-mutationen. DNA-sekvensering
bekräftade att den enda förändringen i sekvensen är vid kodon 61 med en Q61H, CAA>CACförändring. Denna klon blandas därefter med KRAS Control Wild-Type-DNA för att skapa en
heterozygot blandning.
"KRAS Positive Control Exon 4A" konstruerades genom syntes av KRAS Exon 4 med
användning av ovanstående referens, men innehållande K117N-mutationen. DNA-sekvensering
bekräftade att den enda förändringen i sekvensen är vid kodon 117 med en K117N, AAA>AATförändring. Denna klon blandas därefter med KRAS Control Wild-Type-DNA för att skapa en
heterozygot blandning.
"KRAS Positive Control Exon 4B" konstruerades genom syntes av KRAS Exon 4 med
användning av ovanstående referens, men innehållande A146T-mutationen. DNA-sekvensering
bekräftade att den enda förändringen i sekvensen är vid kodon 146 med en A146T, GCA>ACAförändring. Denna klon blandas därefter med KRAS Control Wild-Type-DNA för att skapa en
heterozygot blandning.
"NRAS Control Wild-Type" konstruerades genom syntes och kloning av NRAS Exons 2, 3 och 4
med användning av NCBI Reference Sequence NG_007572.
"NRAS Positive Control Exon 2" konstruerades genom syntes av NRAS Exon 2 med
användning av ovanstående referens, men innehållande G12D-mutationen. DNA-sekvensering
bekräftade att den enda förändringen i sekvensen är vid kodon 12 med en GGT>GAT-förändring.
Denna klon blandas sedan med NRAS Control Wild-Type-DNA för att skapa en heterozygot
blandning.
"NRAS Positive Control Exon 3" konstruerades genom syntes av NRAS Exon 3 med
användning av ovanstående referens, men innehållande Q61K-mutationen. DNA-sekvensering
bekräftade att den enda förändringen i sekvensen är vid kodon 61 med en Q61K, CAA>AAAförändring. Denna klon blandas sedan med NRAS Control Wild-Type-DNA för att skapa en
heterozygot blandning.
"NRAS Positive Control Exon 4" konstruerades genom syntes av NRAS Exon 4 med
användning av ovanstående referens, men innehållande A146T-mutationen. DNA-sekvensering
bekräftade att den enda förändringen i sekvensen är vid kodon 146 med en A146T, GCC>ACCförändring. Denna klon blandas sedan med NRAS Control Wild-Type-DNA för att skapa en
heterozygot blandning.
Bruksanvisning för CRC RAScan Kit med DHPLC-system
Sid. 6
5 komponenter
5 Komponenter
CRC RAScan Combination Kit tillhandahålls i ett ytterhölje som två separata kartonger: (a) en låda
med reagenser för analys av KRAS Exons 2, 3 och 4 och (b) en låda med reagenser för analys av
NRAS Exons 2, 3 och 4. Tillsammans innehåller lådorna tillräckligt med reagenser frö att utföra det
antal analyser som anges i avsnitt 5.3.
5.1 Låda med SURVEYOR Scan KRAS Kit Exons 2, 3 & 4 (h 710107)
Lådan med komponenter för analys av KRAS Exons 2, 3 och 4 har två innerkartonger: (1) a
SURVEYOR Digestion Components Box med 10 reagensrör och (2) en yttre PCR
Components and Controls Tube-Holder som innehåller 20 reagensrör.
Katalognummer
Komponent
Färg på
rörets lock
Volym för
130
reaktioner
Lila
Svart
Rosa
Brunt
Rött
3 x 105 µL
2 x 105 µL
2 x 105 µL
2 x 105 µL
250 µL
Genomskinligt
Genomskinligt
Genomskinligt
Blått
Blått
Blått
Blått
Blått
Blått
Blått
Blått
Gult
Grönt
Grönt
Grönt
Grönt
Orange
Orange
2 x 100 µL
1 mL
2 x 500 µL
125 µL
125 µL
90 µL
90 µL
90 µL
90 µL
90 µL
90 µL
120 µL
40 µL
40 µL
40 µL
40 µL
125 µL
125 µL
Låda med SURVEYOR nedbrytningskomponenter
710160
710161
708049
708027
708030
SURVEYOR Nuclease W
SURVEYOR Enhancer W2
SURVEYOR Enhancer Cofactor
0,15 M MgCl2 Solution
Stop Solution
Låda med PCR-komponenter och kontroller
703310
703315
703065
710155F
710155R
710157F
710157R
710154F
710154R
710156F
710156R
710131
710135
710136
710137
710138
710153F
710153R
DNA Polymerase
10x DNA Polymerase Reaction Buffer
dNTPs (10 mM)
KRAS Primer: Exon 2 Forward (10 µM)
KRAS Primer: Exon 2 Reverse (10 µM)
KRAS Primer: Exon 3 Forward (10 µM)
KRAS Primer: Exon 3 Reverse (10 µM)
KRAS Primer: Exon 4A Forward (10 µM)
KRAS Primer: Exon 4A Reverse (10 µM)
KRAS Primer: Exon 4B Forward (10 µM)
KRAS Primer: Exon 4B Reverse (10 µM)
KRAS Control Wild-Type
KRAS Positive Control Exon 2
KRAS Positive Control Exon 3
KRAS Positive Control Exon 4A
KRAS Positive Control Exon 4B
Universal Sequencing Primer 1 (10 µM)
Universal Sequencing Primer 2 (10 µM)
Bruksanvisning för CRC RAScan Combination Kit med DHPLC-system
Sid. 7
5 komponenter
5.2 Låda med SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 (h 710400)
Lådan med komponenter för analys av NRAS Exons 2, 3 och 4 har två innerkartonger: (1) en
SURVEYOR låda med nedbrytningskomponenter med 10 reagensrör och (2) en yttre PCRkomponenter och kontrollrörshållare som innehåller 14 reagensrör.
Katalognummer
Komponent
Färg på
rörets lock
Volym för
100
reaktioner
Lila
Svart
Rosa
Brunt
Rött
Orange
Orange
2 x 105 µL
105 µL
105 µL
105 µL
250 µL
2 x 125 µL
2 x 125 µL
Rött
Rött
Genomskinligt
Genomskinligt
Blått
Blått
Blått
Blått
Blått
Blått
Gult
Grönt
Grönt
Grönt
100 µL
20 µL
1 mL
500 µL
90 µL
90 µL
90 µL
90 µL
90 µL
90 µL
120 µL
40 µL
40 µL
40 µL
Låda med SURVEYOR nedbrytningskomponenter
710160
710161
708049
708027
708030
710153F
710153R
SURVEYOR Nuclease W
SURVEYOR Enhancer W2
SURVEYOR Enhancer Cofactor
0,15 M MgCl2 Solution
SURVEYOR Stop Solution
Universal Sequencing Primer 1 (10 µM)
Universal Sequencing Primer 2 (10 µM)
Låda med PCR-komponenter och kontroller
703310
703312
703315
703065
710452F
710452R
710453F
710453R
710454F
710454R
710441
710442
710443
710444
DNA Polymerase (250 U)
DNA Polymerase (50 U)
DNA Polymerase 10X PCR Buffer
dNTPs (10 mM)
NRAS Primer Exon 2 Forward (10 µM)
NRAS Primer Exon 2 Reverse (10 µM)
NRAS Primer Exon 3 Forward (10 µM)
NRAS Primer Exon 3 Reverse (10 µM)
NRAS Primer Exon 4 Forward (10 µM)
NRAS Primer Exon 4 Reverse (10 µM)
NRAS Control Wild-Type Mix
NRAS Positive Control Exon 2
NRAS Positive Control Exon 3
NRAS Positive Control Exon 4
5.3 Antal prover som kan testas med ett kit
CRC RAScan Combination Kit är utformad för att räcka till analys av 230 reaktioner. Det totala
antal prover som kan testas med kittet beror på den genomsnittliga satsstorleken som testas vid
ett tillfälle eftersom en uppsättning kontrollreaktioner (Wild-Type Controls, Positive Controls och
kontroller utan templat) måste inkluderas i varje reaktionsplatta. Tabellen nedan anger vilket antal
prover som kan analyseras med ett KRAS- och NRAS-kit beroende på storleken på en
genomsnittlig sats. I tabellen beaktas (a) de 21 kontrollerna (7x Wild-Type, 7x Positive Controls, 7x
kontroller utan templat) som krävs för varje körning och (b) gränsen på 230 reaktioner per kit.
Obs! Om flera plattor körs, måste en uppsättning med de 21 kontroller som anges ovan köras på
varje platta. Därför kräver två plattor sammanlagt 42 kontrollreaktioner, 3 plattor kräver 63
kontrollreaktioner, o.s.v.
Bruksanvisning för CRC RAScan Combination Kit med DHPLC-system
Sid. 8
5 komponenter
Med en större provsatsstorlek ökar antalet prover som kan testas med ett kit, vilket minskar den
genomsnittliga reagenskostnaden per prov. Nedanstående tabell ger en vägledning till hur många
prover som kan testas med kiterna.
Totalt
antal
provsatskörningar
per kit
Totalt
antal
prover
som
testas
per kit
Provsatsstorlek
Antal kontrollreaktioner +
antal provamplikoner
Antal
reaktioner
som krävs
per körning
1
21 + 7
28
8
8
2
21 + 14
35
6
12
3
21 + 21
42
5
15
4
21 + 28
49
4
16
5
21 + 35
56
4
20
5.4 DNA-sekvensering
Sekvenseringsprimers (PN 710153F och 710153R) tillhandahålls för användning vid DNAsekvensering av alla testade prover. De PCR-amplikoner som skapas före SURVEYOR Nucleasenedbrytning bör användas för sekvensering.
6 Ytterligare nödvändig utrustning och reagenser
Ytterligare komponenter och utrustning som behövs för att använda CRC RAScan Combination Kit
med DHPLC innefattar det följande:
DHPLC-system, kolumn, buffertar, DNA-storleksmarkör
- se Bilaga A.3.1 DHPLC-specifikationer för SURVEYOR Scan-användningar
beträffande egenskaper för ett lämpligt DHPLC-system för användning med detta kit
Vatten för molekylärbiologi
0,2 mL-PCR-rör, remsor eller platta med 96 brunnar
Mikropipetter
Pipettspetsar
Isbad
Vortexblandare
Mikrocentrifug
Termocykler
Agarosgeler och utrustning för agarosgelelektrofores
10 % blekmedel eller liknande rengöringsmedel
7 Reagensberedning
Alla reagenser som ingår i detta kit är användningsklara. En del komponenter behöver tinas upp,
och/eller blandas i en vortex-blandare eller mikrocentrifug före användningen. Se mer information
under Analysproceduren, nedan. Reagenser behöver kombineras för att producera Master Mixblandningar och reaktionsblandningar. En fullständig beskrivning ges under Analysprocedur
nedan.
Bruksanvisning för CRC RAScan Combination Kit med DHPLC-system
Sid. 9
8 Förvaring och hållbarhet
8 Förvaring och hållbarhet
Detta kit skall förvaras i mellan–18 ºC och -25 °C i en frys med konstant temperatur tills dess det
används. Observera utgångsdatumet på varje kit du erhåller. Använd inte kittet efter passerat
utgångsdatum.
SURVEYOR Nuclease-blandningen som tillreds i Steg 7 av SURVEYOR Nuclease-nedbrytning
ska användas omedelbart eftersom SURVEYOR Nuclease W avaktiveras med tiden när det
förekommer tillsammans med övriga komponenter i SURVEYOR Nuclease-reaktionsblandning.
9 Varningar och försiktighetsåtgärder
Ingen av reagenserna i detta kit utgör en hälsorisk i de kvantiteter som förekommer.
Transgenomics dokumentnr. MSD-710107 kan hämtas från
http://world.transgenomic.com/files/literature/710077-SV.pdf
Det finns inga ämnen i detta kit med animaliskt eller humant ursprung som innebär en
infektionsrisk.
Detta kit skall bara användas av personer som har utbildats i korrekta laboratorietekniker. Använd
alltid lämplig laboratorierock, engångshandskar och ögonskydd vid arbete med komponenterna i
detta kit. Efter användningen ska kittets komponenter kasseras som sjukvårdsavfall och enligt
lokala lagar och föreskrifter.
Alikvoter av reagens som pipetterats från rören i detta kit är endast avsedda för engångsbruk.
Komponenterna i detta kit har validerats som fortfarande stabila efter 25 upptiningscykler. Använd
inte detta kit om antalet upptiningscykler har överskridits.
10. Förberedande provinsamling, hantering och förvaring
CRC RAScan Combination Kit har validerats för användning med DNA som utvunnits från
formalinfixerade paraffininbäddade (FFPE) kolorektala cancertumörprover. För optimal DNAextraktion ska vävnaden fixeras i formalin i 14-24 timmar innan den bäddas in i paraffin.
Tumörbiopsier är en heterogen blandning av tumörceller och icke-tumörceller. Vidare är själva
tumörcellen en heterogen blandning av tumörceller med mutationer och tumörceller utan
mutationer. Eftersom dessa somatiska mutationer kanske inte är jämnt fördelade i tumören, kan
den analysresultaten från olika sektioner i samma tumör skilja sig åt. För att öka möjligheten att
upptäcka en mutation, bör DNA från vävnadens tumörregion isoleras genom att endast
tumörområdet skrpas från objektglaset med en ny, steril skalpell för varje nytt objektglass.
För framgångsrik användning av detta kit bör den extraherade DNA:n uppfylla kriterierna i Att
tänka på avseende templat.
OBS! Extraherade DNA-prover som inte används för omedelbar analys ska förvaras vid -20 ºC till
-80 ºC.
Bruksanvisning för CRC RAScan Kit med DHPLC-system
Page 10
11 Analysprocess
11 Analysprocess
11.1 Somatisk mutationsdetektion med SURVEYOR Scan-kit - En översikt
Detektion och bekräftelse av mutationer med SURVEYOR Nuclease omfattar tre steg:
Steg 1 - Förbered PCR-amplikoner från muterat (test) och normalt (referens) DNA, och
fortsätt efter den sista PCR-amplifieringscykeln med att smälta alla dubbla strängar och
därefter långsamt låta dem svalna för optimal uppkomst av hetero- och homoduplexer
(heteroduplexer uppstår när en sträng i en Wild-Type-sekvens härdas med en sträng av
en muterad sekvens).
Steg 2 – Behandla en del av den härdade heteroduplex/homoduplex -blandningen med
SURVEYOR Nuclease. SURVEYOR Nuclease skär av båda strängarna av heteroduplex
DNA så att DNA-fragment bildas. Control Wild-Type-DNA utgör, när den behandlas på
liknande sätt, en bakgrundskontroll.
Steg 3 - Analysera DNA-fragmenten på ett DHPLC-system. Formeringen av nya kluvna
produkter, till följd av förekomsten av en eller flera avvikelser, påvisas genom förekomsten
av ytterligare kromatografiska toppar. Migrationstiderna för de kluvna produkterna anger
storleken på fragmenten och därmed avvikelsens eller avvikelsernas placering.
Bruksanvisning för CRC RAScan Combination Kit med DHPLC-system
Sid. 11
12 Stegvisa anvisningar
12 Stegvisa anvisningar
12.1 INLEDANDE installation/kalibrering av DHPLC
När SURVEYOR Nuclease-plattan ställs in för analys av DHPLC, se Bilaga A.3 Systemkrav för
denaturering med HPLC (DHPLC).
12.2 Att tänka på före KRAS- och NRAS-provanalys
Innan prover körs på ett DHPLC-system måste en lämplig DNA-storleksmarkör köras för att
tillförsäkra att systemet fungerar korrekt. Laboratoriepersonal som använder instrumentet bör
kontrollera DNA-storleksmarkörens kvalitet innan analysen startas.
12.3 Att tänka på avseende templat
1. För FFPE isolerad DNA-templat, använd normala laboratorierutiner för att bedöma kvalitet
och kvantitet på extraherad DNA för att se till att det finns tillräckligt templat för PCR.
2. 260/280 absorptionsförhållandet skall vara över1,80
3. För att underlätta PCR-inställningen bör den effektiva koncentrationen av templat vara
12,5 ng/µL. Späd ut DNA-förlagorna med graderat molekylärbiologiskt vatten om så
behövs.
12.4 Att tänka på avseende arbetsflödet
Kittet är avsett att möjliggöra analys av 230 reaktioner. Mindre provsatser kan köras, men
kitkontroller och en "kontroll utan templat" måste inkluderas med varje provsats. Det finns
tillräckligt med kontrollsubstans i kittet för 230 reaktioner av alla provomgångar av alla olika
storlekskombinationer.
I allmänhet bör bearbetning av alla prov utföras från början till slut enligt beskrivningen i den här
bruksanvisningen. Om bearbetningen av ett prov stoppas innan alla steg är klara, ska DNA
förvaras i -20°C vid angivna punkter. Man bör dock undvika att utsätta ett fruset prov för upprepad
upptining och förvaring (-18 till -25 °C) av PCR-amplifierad DNA eller SURVEYOR Nuclease
nedbrytningsprodukter under längre perioder (>1 vecka).
Bruksanvisning för CRC RAScan Kit med DHPLC-system
Page 12
12 Stegvisa anvisningar
Analys av prover bör följa nedan illustrerade arbetsflöde:
Skrapa vävnad
DNAisolering
och PCR
1
2
Gelelektrofores
3
Ange Robust/Svag PCR
4
5
SURVEYOR
Scan
Misslyckades
SURVEYOR Nuclease
och
DHPLC Analysis
SURVEYOR Scan
Positiv
SURVEYOR Scan
Negativ
7
6
NVD
Sekvensbekräftelse
8
Sekvenskvalitet
Misslyckades
Sekvenskvalit
et godkänd
9
Mutationer i KRAS
eller NRAS
kodoner G12, G13,
A59, Q61, K117
eller A146
NVD
Figur 3: Arbetsflöde för analys med CRC RAScan Combination Kit
Bruksanvisning för CRC RAScan Kit med DHPLC-system
Page 13
12 Stegvisa anvisningar
Anmärkningar till figur 3
1. Isolera DNA från FFPE med vedertagen laboratorieteknik.
2. Utför PCR och kontrollera DNA-kvaliteten med gelelektrofores.
3. Registrera om PCR-bandet är robust (≥20 ng/µL) eller svagt (<20 ng/µL).
Om det finns flera PCR-band ska ny genomisk DNA beredas från FFPE.
4. Gå vidare till SURVEYOR Nuclease-behandling och DHPLC systemanalys med prover
som angetts som antingen robust PCR eller svag PCR efter PCR-amplifiering.
Observera ett det vid en svag PCR-bestämning kan finnas otillräcklig DNA för att få
meningsfulla resultat genom DHPLC, men det kan finnas tillräckligt med DNA för
sekvensering.
5. Se Bilaga B – Felsökningsguide för exempel på misslyckade SURVEYOR Scanresultat. Alla prover med ett misslyckat SURVEYOR Scan-resultat bör köras om antingen
genom att:
a. upprepa PCR om det finns tillräckligt med genomisk DNA kvar
b. extrahera DNA från FFPE på nytt; detta bör vara sekundärt val eftersom det ofta
inte är önskvärt att skära ytterligare ett FFPE-block.
c.
om en annan sektion eller block används måste hela analysen göras om eftersom
avvikelser i nedbrytningen kan bero på tumörheterogenicitet.
6. Om det inte finns några synliga klyvningstoppar ska ett negativt SURVEYOR Scanresultat registreras, d.v.s. NVD = No Variant Detected (ingen avvikelse detekterad).
7. Om ett prov visar SURVEYOR Nuclease klyvningsprodukter (matchar inte relevant WildType-Control) ska dessa skickas till sekvenseringsbekräftelse.
8. Om sekvensbekräftelseanalysen inte godkänns, ska man antingen:
a. upprepa PCR om det finns tillräckligt med genomiskt DNA kvar
b. extrahera DNA från FFPE på nytt; detta bör vara sekundärt val eftersom det ofta
inte är önskvärt att skära ytterligare ett FFPE-block.
9. Om sekvensbekräftelseanalysen är godkänd bör resultaten visa antingen:
a. Wild-Type-sekvens, d.v.s. ingen avvikelse detekterad (NVD -No Variant
Detected); eller
b. Avvikelse detekterad. Om sekvensbekräftelsen visar någon basförändring som
leder till aminosyraförändring vid:
i. kodon 12 eller 13
ii. kodon 59 eller 61
iii. kodon 117; eller
iv. kodon 146
bedöm som positiv för KRAS- eller NRAS-mutation.
Obs! Det är möjligt att ha en positiv SURVEYOR Scan-bestämning som också ger resultatet
"Ingen avvikelse detekterad" vid ett sekvensbekräftelsetest. Detektionsnivån (LOD) för
SURVEYOR Nuclease på ett DHPLC-system är så låg som 2% mutation i 98% Wild-Type-DNA för
vissa mutationer, medan LOD för sekvensering är cirka 10-25% mutation i 90-75% Wild-TypeDNA.
OBS! om ett prov är 100% muterat DNA, kan inga heteroduplex bildas och provet kommer att
visas som "Wild-Type". Tumörbiopsiprover kommer emellertid att innehålla Wild-Type-celler på
grund av tumörheterogenitet och/eller kontaminerande normal vävnad.
Obs! Prover med 5% och 95% muterat DNA kommer att ha identitiska kromatogram.
Bruksanvisning för CRC RAScan Combination Kit med DHPLC-system
Sid. 14
12 Stegvisa anvisningar
Obs! Positiva SURVEYOR Scan-resultat kan bero på andra basförändringar än de som har
befunnits vara KRAS- eller NRAS-aktiverande. Dessa mutationer är sällsynta och måste bekräftas
av en annan metod, t.ex. DAN-sekvensering, för att fastställa om det positiva SURVEYOR Scanresultatet är en KRAS-eller NRAS-aktiverande mutation eller ej.
OBS! Den formalinfixationsprocess som används vid beredning av FFPE-tumörbiopsiprover kan
orsaka deaminering av cytosin. Denna deaminering omvandlar cytocin till uracil. Polymerasen
kommer att "läsa" detta uracil som tymin och införliva en adenin i de kopierade strängarna. Detta
kommer sedan att se ut som en mutation där den normala G nu har bytts ut mot A som orsakar en
GC- till AT-mutation, vilket är en artefaktmutation på grund av fixationsprocessen och inte en äkta
somatisk mutation. Detta förekommer sällan, men om de kopieras tidigt under PCR-cykeln
kommer de att "se ut som" mutationer. De upprepas inte vid omanalys.
Exempel på potentiella cytosindeamineringsmutationer som skulle kunna beaktas vid beslut av
patientvård är för KRAS:
-
Kodon 12: AGT (G12S) och GAT (G12D)
-
Kodon 13: AGC (G13S), GAC (G13D) och GGT (G13G, en tyst mutation)
-
Kodon 146: GCA>ACA (A146T)
Exempel på potentiella cytosindeamineringsmutationer som skulle kunna beaktas vid beslut av
patientvård är för NRAS:
-
Kodon 12: GGT> AGT (G12S) eller GAT (G12D)
-
Kodon 13: GGT> AGT (G13S), GAT (G13D) eller GGC (G13G, en tyst mutation)
-
Kodon 146: GCC>ACC (A146T)
Därför rekommenderas att sådana mutationer bekräftas med duplikatanalys av samma genomiska
DNA eller att alla prover omfattas av duplikatanalys från analysens början.
12.5 Amplifieringsprotokoll
1. Transgenomics förblandade dNTP-lösningar (PN 703065 och 705020) tillhandahålls med
en koncentrationsgrad av 10 mM total deoxynukleotid (2,5 mM av var och en av de fyra
deoxynukleotiderna).
2. KRAS och NRAS Forward and Reverse PCR primers (KRAS PN 710155F/R, 710157F/R,
710154F/R och 710156F/R; NRAS PN 710452F/R, 710453F/R och 710454F/R)
tillhandahålls vid 10 µM.
3. Ta ut 10 µM-primrar, 10 mM dNTP:er och DNA Polymerase 10X PCR Buffer (PN 703315)
ur frysen och tina på is.
4. Vortexblanda alla komponenter efter upptining (~10 sekunder) så att de blandas noga,
centrifugera en kort stund (~10 sekunder) för att tillförsäkra att ingen vätska finns kvar på
rörens lock och lägg på is.
5. Förbered Master Mix-blandningarna på is.
6. Använd nedanstående tabell som en vägledning för beredning av en Master Mix för var
och en av KRAS Exon 2-, KRAS Exon 3-, KRAS Exon 4A-, KRAS Exon 4B-, NRAS Exon
2-, NRAS Exon 3- och NRAS Exon 4-reaktionerna:
Antal reaktioner (7 prover + 3 kontroller):
Volymberäkning:
Vattenvolym (µL)
DNA Polymerase 10X PCR Buffer (µL)
dNTP:er (µL)
Forward Primer (µL)
Reverse Primer (µL)
DNA Polymerase (µL)
Total volym Master Mix
Bruksanvisning för CRC RAScan Combination Kit med DHPLC-system
10
330**
50
40
25
25
10
48,0
Sid. 15
12 Stegvisa anvisningar
**OBS! Användaren bör sträva efter att ha minst 25 ng DNA per 50 µL PCR-reaktion.
När de extraheras är DNA-koncentrationerna mindre än 12,5 ng/µL, öka volymen
extraherat DNA proportionerligt för att tillförsäkra 25 ng per reaktion. Minska vidare
volymen vatten i Master Mix-blandningen med samma mängd för att få 50 µL per reaktion.
Alla prover som prepareras med dessa Master Mix-blandningar kommer att behöva
extraherad DNA som har spätts ut till ungefär samma lägsta koncentrationsgrad. Vi
rekommenderar inte att koncentrationer av extraherad DNA på <5 ng/µL används.
7.
Beräkna nödvändiga volymer för alla angivna Master Mix-blandningar med användning av
ovanstående tabell. Observera att:
(a) För Master Mix 1, KRAS Exon 2, krävs tre ytterligare reaktioner per provplatta:
KRAS Control Wild-Type, KRAS Positive Control Exon 2 samt KRAS Exon 2
kontroll utan templat (NTC1).
(b) För Master Mix 2, KRAS Exon 3, krävs tre ytterligare reaktioner per provplatta:
KRAS Control Wild-Type, KRAS Positive Control Exon 3 samt KRAS Exon 3
kontroll utan templat (NTC2).
(c) För Master Mix 3, KRAS Exon 4A, krävs tre ytterligare reaktioner per provplatta:
KRAS Control Wild-Type, KRAS Positive Control Exon 4A samt KRAS Exon 4A
kontroll utan templat (NTC3).
(d) För Master Mix 4, KRAS Exon 4B, krävs tre ytterligare reaktioner per provplatta:
KRAS Control Wild-Type, KRAS Positive Control Exon 4B samt KRAS Exon 4B
kontroll utan templat (NTC4).
(e) För Master Mix 5, NRAS Exon 2 kommer ytterligare tre reaktioner att behövas
per provplatta för NRAS Control Wild-Type, NRAS Positive Control Exon 2 och
NRAS Exon 2 kontroll utan templat (NTC5).
(f) För Master Mix 6, NRAS Exon 3 kommer ytterligare tre reaktioner att behövas per
provplatta för NRAS Control Wild-Type, NRAS Positive Control Exon 3 och NRAS
Exon 3 kontroll utan templat (NTC6).
(g) För Master Mix 7, NRAS Exon 4 kommer ytterligare tre reaktioner att behövas per
provplatta för NRAS Control Wild-Type, NRAS Positive Control Exon 4 och NRAS
Exon 4 kontroll utan templat (NTC7).
OBS! Beakta att en Master Mix-volym som är något större är denna beräkning krävs
för att ge utrymme för visst svinn vid pipettering.
8. Märk 0,2 mL PCR-rören eller brunnarna i en 96-hålsplatta med vederbörlig
provinformation.
9. Märk 2,0 mL centrifugeringsrör för preparering av Master Mix-blandning.
10. Tillsätt nödvändig volym vatten för molekylärbiologi till 2,0 mL centrifugeringsrör som är
märkta Master Mix.
11. Tillsätt nödvändig mängd DNA Polymerase 10X PCR Buffer till Master Mix-rören.
12. Tillsätt nödvändig mängd 10 mM dNTP:er till Master Mix-rören.
13. Tillsätt nödvändig mängd KRAS eller NRAS Forward Primer till respektive Master Mix-rör.
14. Tillsätt nödvändig mängd KRAS eller NRAS Reverse Primer till respektive Master Mix-rör.
15. Ta ut DNA Polymerase (PN 703310) ur frysen.
16. Centrifugera DNA Polymerase i ~10 sekunder.
17. Vortexblanda DNA Polymerase i ~10 sekunder.
18. Tillsätt nödvändig mängd DNA Polymerase till Master Mix-rören.
19. Förslut Master Mix-rören.
20. Vortexblanda Master Mix-rören i ~30 sekunder och centrifugera under en kort stund i ~10
sekunder före användning.
21. Förvara på is tills det används.
Bruksanvisning för CRC RAScan Combination Kit med DHPLC-system
Sid. 16
12 Stegvisa anvisningar
22. Pipettera 48,0 µL (se anmärkning ovan i steg 6) av Master Mix-blandningen i lämpliga
brunnar och byt pipettspets om du använder en pipett med en kanal. Se till att det inte
spiller eller stänker mellan hålen om en repeterpipett används. Förvara plattan på is.
23. Tillsätt 2,0 µL (se anmärkning ovan i steg 6) av varje provtemplat-DNA eller vatten (NTC no template control) till lämpliga brunnar. Använd separata pipettspetsar för varje prov och
undvik korskontamineriong av proverna genom stänk. Förslut alla brunnar med med provDNA och NTC med remsor med 8 proppar (om du använder en 96-hålsplatta) eller sätt på
proppar på 0,2 mL PCR-rören. Se till att propparna sluter till ordentligt.
24. Endast därefter ska kittets kontrolltemplat-DNA (PNs 710131, 710135, 710136, 710137,
710138, 710441, 710442, 710443 & 710444) öppnas ett i taget. Pipettera 2,0 µL av var
och en av kontrolltemplaten sist för att minska risken för att något prov-DNA
kontamineras. När pipetteringen är klar, slut till alla brunnar med remsor med 8 proppar
(om du använder en 96-hålsplatta) eller sätt på proppar på 0,2 mL PCR-rören. Se till att
propparna sluter till ordentligt.
OBS! Det är god laboratoriepraxis att placera kontroller utan templat (NTC) i brunnar som
inte ligger intill Positive Controls eller prover.
OBS! För förslag på hur plattor med 96 brunnar kan arrangeras för analys av alla KRAS
och NRAS Exons 2-4, se Bilaga A.1 Översikt av platta för SURVEYOR Scan-kit.
25. Vortexblanda (~1/2 hastighet) i 10 sekunder.
26. Centrifugera i 1-2 minuter för att tillförsäkra att alla lösningar samlas i botten av brunnarna
eller rören. Kontrollera att lösningarna är på botten av brunnen eller röret. Upprepa
centrifugeringen i annat fall.
12.6. Termocykelprogram för amplifieringsprotokoll
1. Använd följande termocykelprotokoll för PCR-amplifiering och heteroduplexformering:
15 cykler
30 cykler
1 cykel
Inledande denaturering
95 C
Touchdown-amplifiering
95 C
62 C, -0,5 ºC/cykel
72 C
Amplifiering
95 C
55 C
72 C
Slutgiltig förlängning
72 C
Heteroduplex formering
95 ºC
≤12 C
5 minuter
30 sekunder
30 sekunder
25 sekunder
30 sekunder
30 sekunder
25 sekunder
2 minuter
2 minuter
Paus
12.7 Kvalitetskontroll av PCR-produkter
1. Kvaliteten och kvantiteten på amplikoner bör kontrolleras med gelelektrofores (eller
motsvarande) innan du fortsätter med SURVEYOR Nuclease-nedbrytning.
2. Analysera en alikvot av PCR-produkt tillsammans med flera olika mängder av en 100-bp
DNA-stege.
3. Använd stegen till att beräkna koncentrationen av amplifierad DNA.
4. Bara ett enda band >20 ng/µL som motsvarar huvud-PCR-produkten ska synas.
5. Om det finns flera band, se till att kvaliteten på tillsatt DNA-templat var tillräckligt god (se
Bilaga B – Felsökningsguide).
Bruksanvisning för CRC RAScan Combination Kit med DHPLC-system
Sid. 17
12 Stegvisa anvisningar
6. Om ingen produkt kan iakttas, se till att kvaliteten på tillförd DNA-templat var tillräckligt
god (se Bilaga B – Felsökningsguide). Om kvaliteten motsvarar specifikationerna, ska
du öka volymen på templatet till 4,0 µL per 50 µL reaktion (minska vattenmängden per
reaktion till 31,0 µL).
7. Inga PCR-produkter ska synas i kontrollprovet utan templat. Om DNA-produkt kan iakttas
är kontrollen troligen kontaminerad, se Bilaga B – Felsökningsguide.
8. Ange PCR som robust eller svag PCR.
a. Robust PCR ska ha ett enda band med minst 20 ng/µL.
b. Svag PCR ska ha ett enda band med mindre än 20 ng/µL.
c.
Fortsätt med SURVEYOR Nuclease-nedbrytning vid såväl robusta som svaga
PCR-bedömningar.
TIPS: I det här stadiet kan PCR-produkter förvaras vid -20 ºC eller kallare i upp till en
vecka.
12.8 SURVEYOR Nuclease-nedbrytning
1. När prov-PCR har bedömts vara av tillräckligt hög kvalitet och kvantitet, ska nedbrytning
med SURVEYOR Nuclease utföras enligt beskrivningen nedan. En provkoncentration om
minst 40 ng/uL krävs för optimal nedbrytning med SURVEYOR Nuclease
2. Tina rören med 0,15 M MgCl2 Solution och SURVEYOR Enhancer Cofactor på is.
3. Tillsätt 10,0 µL av varje PCR-amplifierat prov till ett nytt 0,2 mL PCR-rör eller brunn på en
platta med 96 brunnar.
4. Bered en ny blandning 0,15 M MgCl2 Solution, SURVEYOR Enhancer Cofactor,
SURVEYOR Enhancer W2 och SURVEYOR Nuclease W (SURVEYOR Nucleaseblandning).
Använd följande tabell som en vägledning för beredning av Master Mix för SURVEYOR Nucleasenedbrytning för analys av flera prover. Nedanstående exempel har volymer för en Master Mix för
10 prover.
Tänk på att en Master Mix-volym som är något större än denna beräkning krävs för att ge utrymme
för svinn vid pipettering.
Antal SURVEYOR Nuclease-nedbrytningsreaktioner:
Volymberäkning:
0,15 M MgCl2 Solution (µL)
SURVEYOR Enhancer Cofactor (µL)
SURVEYOR Enhancer W2 (µL)
SURVEYOR Nuclease W (µL)
Total volym Master Mix:
Tillsätt 5 µL SURVEYOR Nuclease Master Mix till varje
PCR-amplifierat prov (µL)
Total volym SURVEYOR Nucleasenedbrytningsreaktion:
10
10,0
10,0
10,0
20,0
50,0
10,0
15,0
a. Centrifugera alla reagenser före användning.
b. Vortexblanda varje reagens försiktigt före pipettering; centrifugera under en kort stund
i ~10 sekunder efter varje vortexmoment.
Bruksanvisning för CRC RAScan Combination Kit med DHPLC-system
Sid. 18
12 Stegvisa anvisningar
c.
För varje nedbrytning, tillför följande komponenter till ett 0,2 mL PCR (eller större)
mikrocentrifugeringsrör.
1,0 µL 0,15 M MgCl2 Solution (PN 708027)
1,0 µL SURVEYOR Enhancer Cofactor (PN 708049)
1,0 µL SURVEYOR Enhancer W2 (PN 710161)
2,0 µL SURVEYOR Nuclease W (PN 710160)
Eller tillsätt 5 µL Master Mix som beretts enligt ovanstående tabell.
5. Vortexblanda försiktigt Master Mix för SURVEYOR Nuclease-nedbrytning i 10 sekunder
på låg hastighet.
6. Centrifugera Master Mix för SURVEYOR Nuclease-nedbrytning i 10 sekunder på låg
hastighet.
7. Placera Master Mix för SURVEYOR Nuclease-nedbrytning på is tills den är redo att
användas.
Obs! Master Mix för SURVEYOR Nuclease-nedbrytning som beretts i steg 7 ska
användas omedelbart eftersom SURVEYOR Nuclease W blir inaktivt över tid vid
förekomst av de övriga komponenterna i Master Mix för SURVEYOR Nucleasenedbrytning.
8. Pipettera 5,0 µL-alikvot av Master Mix för SURVEYOR Nuclease-nedbrytning i varje rör
eller brunn med 10,0 µL alikvot av amplifierad PCR-produkt (se steg 3 ovan).
9. När pipetteringen är klar, centrifugera 0,2 mL PCR-rör eller plattan med 96 brunnar i 10
sekunder.
10. Vortexblanda försiktigt 0,2 mL PCR-rör eller plattan med 96 brunnar i 10 sekunder.
11. Centrifugera i 10 sekunder med låg hastighet (detta moment är extra viktigt om
nedbrytningen sker i ett instrument som saknar uppvärmt lock).
12. Inkubera vid 42 °C i 30 minuter.
13. Tillsätt 1,0 µL SURVEYOR Stop Solution (PN 708030) i varje rör eller brunn och
vortexblanda försiktigt (total SURVEYOR Nuclease-reaktionsvolym är 16,0 µL).
TIPS: SURVEYOR nedbrytningsprodukter kan lagras vid ≤ -20 ºC i upp till en vecka.
14. Ladda provnedbrytningarna i ett DHPLC-system.
Obs! För föreslagna gradientinställningar för DHPLC-systemet för analys av SURVEYOR
Nuclease-nedbrytningar,
besök
http://world.transgenomic.com/diagnostic-tools/geneticanalysis-kits/crc-rascan-kits-eu/dhplcsystemsettings.
Bruksanvisning för CRC RAScan Combination Kit med DHPLC-system
Sid. 19
13 Kontrollparametrar
13 Kontrollparametrar
13.1 Kvalitetskontroll av CRC RAScan Combination Kit
Kontroll-DNA-plasmider ingår i detta kit för att tillhandahålla kvalitetskontroller vid specifika steg i
analysprocessen. För amplifieringsprotokollet, erbjuder dessa kontroller ett sätt att säkerställa
att Master Mix-blandningarna är korrekt preparerade och att amplifieringen fungerar korrekt.
Kontrollsubstanser utan templat (där vatten tillförs istället för DNA-templat) krävs också för att
kontrollera förekomsten av eventuell kontamination av kitkomponenter från ett ovidkommande
DNA-templat.
I nedbrytningsstadiet av SURVEYOR Nuclease, tillhandahåller amplikonerna från dessa kontrollDNA-plasmider en effektiv kontroll av klyvningsreaktionsförhållanden (beredning av Master Mix för
SURVEYOR Nuclease-nedbrytning och inkubationsförhållanden) har varit tillfredsställande. I
analysstadiet ger DHPLC System kromatogram av SURVEYOR Nuclease-nedbrutna
kontrollamplikoner en vägledning huruvida klyvningsprodukttopparna motsvarande den mutationen
i KRAS och NRAS Exons 2, 3 och 4 kommer att elueras även vid låga nivåer (se figurer 4-10).
Klyvningsprodukttoppar som motsvarar andra mutationer i KRAS eller NRAS Exons 2, 3 och 4 kan
elueras i något avvikande positioner.
Om PCR-amplikonerna inte motsvarar resultaten som beskrivs i Kvalitetskontroll av PCRprodukter, se Bilaga B - Felsökningsguide eller kontakta Transgenomics tekniska support innan
du går vidare med ytterligare provanalyssteg.
13.2 Användning av kontrollplasmid-DNA
Detta kit är utrustat med nio kontroll-DNA:
KRAS Control Wild-Type; PN 710131
KRAS Positive Control Exon 2; PN 710135
KRAS Positive Control Exon 3; PN 710136
KRAS Positive Control Exon 4A; PN 710137
KRAS Positive Control Exon 4B; PN 710138
NRAS Control Wild-Type; PN 710441
NRAS Positive Control Exon 2; PN 710442
NRAS Positive Control Exon 3; PN 710443
NRAS Positive Control Exon 4; PN 710444
Dessa kontroll-DNA är plasmider med tillägg. Den Positive Controls innehåller två plasmider: en
blandning av KRAS eller NRAS Control Wild-Type och en mutationsklon som skiljer sig från WildType vid ett enstaka baspar. Kontrollerna tillhandahålls i separata flaskor, var och en med en
koncentration på 105 kopior/µL.
KRAS och NRAS Exons 2, 3 och 4 Forward och Reverse PCR-primrar som krävs för PCRamplifiering
tillhandahålls
separat
i
kitten.
Följ
instruktionerna
som
står
i
Amplifieringsprotokollet, SURVEYOR Nuclease-nedbrytning och Analys av KRAS och NRAS
Exons 2, 3 och 4 med SURVEYOR Nuclease för användning av dessa kontroller.
VI REKOMMENDERAR STARKT ATT NYA ANVÄNDARE FÖRST UTFÖR
EXPERIMENTEN MED ENBART KONTROLLSUBSTANSERNA INNAN TESTNING
GÖRS PÅ GENOMISKA PROVER
Bruksanvisning för CRC RAScan Kit med DHPLC-system
Page 20
14 Tolkning av resultat
14 Tolkning av resultat
14.1 Analys av KRAS och NRAS Exons 2, 3 och 4 med SURVEYOR Nuclease
För jämförelse och kontroll ska man ALLTID utföra SURVEYOR Nuclease-nedbrytning på var och
en av kontrollerna (Wild-Type och Positive Controls), en kontroll utan templat (NTC), samt provDNA som ska köras med samma provplatta i samma DHPLC-system.
I nedbrytningsstadiet av SURVEYOR Nuclease, tillhandahåller amplikonerna från dessa
kontrollplasmid-DNA en effektiv kontroll att förhållandena för klyvningsreaktion (beredning av
SURVEYOR Nuclease-blandning och inkuberingsförhållanden) var tillfredsställande. I
analysstadiet ger DHPLC-systemets kromatogram av SURVEYOR Nuclease-nedbrutna
kontrollamplikoner en vägledning om var DNA-fragmenten efter klyvningen vid dessa specifika
mutationers avvikelseställe kommer att elueras, även vid låga nivåer (se figurerna 4-10).
Om antingen PCR-amplikonerna eller SURVEYOR Nuclease-klyvningsfragment som härletts av
kontroll-DNA inte motsvarar beskrivna resultat, se Bilaga B -Felsökningsguide eller kontakta
Transgenomics tekniska support innan nästa steg i provanalysen tas.
Nedanstående exempel är endast i illustrationssyfte och ska INTE användas för att fastställa
identiteten hos någon viss mutation. Bekräftelse av identiteten hos en mutation krävs för att
oåterkalleligt fastställa förekomsten av en specifik basförändring i Exons 2, 3 eller 4 i KRAS- eller
NRAS-generna.
SURVEYOR Nuclease klyver vid alla avvikelser som uppstår till följd av heteroduplex
formering mellan Wild-Type och muterat DNA, inte bara mutationer i Exons 2, 3 eller 4.
SURVEYOR Nuclease bekräftar att en avvikelse förekommer. Mutationens specifika
basförändringsidentitet krävs för bestämning av KRAS- och NRAS-aktiverande status och den
måste bekräftas med en annan metod, t.ex. sekvensering.
14.2 Granskning av SURVEYOR Scan-resultat
Inspektera kromatogrammen och jämför de för Wild-Type och Positive Controls med provets.
Fastställ om provets kromatogram liknar Wild-Type-mönstret eller ej. Om det är annorlunda bör
provet betraktas som "SURVEYOR Scan-positivt" och skickas till DNA-sekvensanalys. Exempel
på sådana prov finns i figurer 4-10 och Bilaga B – Felsökningsguide, problem 7 och 8.
Ett prov med SURVEYOR Nuclease-mönster som skiljer sig från mönstret för Wild-Type bör
skickas för sekvensbekräftelse även om det inte är identiskt med den Positive Controls. Ett
exempel på ett sådant prov finns i Bilaga B – Felsökningsguide, problem 7.
Zooma vid behov in på området av intresse och lägg provets kromatogram ovanpå Wild-Type
Control för den amplikonen.
Notera skillnader mellan Wild-Type Control och det analyserade provet.
Viktigt! Efter en grundlig genomgång av varje prov bör datagranskaren undersöka om
intilliggande prover i analysplattan har identiska positiva SURVEYOR Scan-resultat. Om identiska
positiva resultat förekommer kan de bero på korskontamination av prov eller kontroll och analysen
måste upprepas.
Bruksanvisning för CRC RAScan Kit med DHPLC-system
Page 21
14 Tolkning av resultat
14.3 Exempel på resultat
Exempel på resultat som erhållits med CRC RAScan Combination Kit med ett DHPLC-system
visas i figurerna 4-10 nedan. I dessa exempel har den metod som beskrivs i Stegvisa
anvisningar med användning av WAVE® 4500HT-HS System med såväl UV- som
fluorescensdetektorer, följts exakt. För föreslagna gradientinställningar för DHPLC-system för
analys av SURVEYOR Nuclease-nedbrytningar, besök http://world.transgenomic.com/diagnostictools/genetic-analysis-kits/crc-rascan-kits-eu/dhplcsystemsettings.
Figur 4A
DHPLC-genomflöde
G12D ger
74- och 116-bpfragment
KRAS Control Wild-Type
KRAS Control Exon 2
OkluvenProv 1, KRAS Exon 2
200-bp Prov 2, KRAS Exon 2
amplikonProv 3, KRAS Exon 2
DNA-storleksmarkör
Okluven
190-bp
amplikon
DHPLCavrinning
Figur 4B
G12D ger
74- och 116-bpfragment
KRAS Control Wild-Type
KRAS Control Exon 2
OkluvenProv 1, KRAS Exon 2
200-bp Prov 2, KRAS Exon 2
amplikonProv 3, KRAS Exon 2
DNA-storleksmarkör
Okluven
190-bp
amplikon
Figurerna 4A och 4B: WAVE DHPLC-analys med UV-detektion (figur 4A) och
fluorescensdetektion (figur 4B) av SURVEYOR Nuclease-nedbrytning av KRAS Positive
Control Exon 2 och KRAS Control Wild-Type samt CRC DNA som isolerats från FFPEsektioner. Vid visuell granskning av kromatogrammen ska de nedbrutna proverna jämföras med
Wild-Type Control (brun linje). KRAS Positive Control Exon 2 (blå linje) är en blandning av WildType och muterade G12D-plasmider som ger nedbrytningstoppar på 74 och 116 bp; denna
kontroll visar att nedbrytningsmomentet i SURVEYOR Nuclease fungerar och visar det område i
kromatografen som bör undersökas visuellt för att fastställa om ett prov ska skickas för DNAsekvensanalys. När nedbrytningsmönster jämförs för proverna 1-3 med Wild-Type ej nedbrutet
kromatogram är det uppenbart att proverna 1 och 2 (röda och turkosa linjer) har sannolika
mutationer och bör sekvenseras för att bekräfta förekomst eller frånvaro av en mutation i relevant
kodon. Prov 3 (grön linje) har liknande kromatogram som de som observeras för Wild-Type
Control och behöver inte skickas för DNA-sekvensanalys. Observera att sekvenseringsresultatet
är det definitiva resultatet eftersom det kan finnas andra ej relevanta mutationer som kan ge
samma fregmentstorlekar.
Bruksanvisning för CRC RAScan Combination Kit med DHPLC-system
Sid. 22
14 Tolkning av resultat
Figur 5A
DHPLCgenomflöde
Q61H ger
65- och 135-bpfragment
KRAS Control Wild-Type
KRAS Control Exon 3
OkluvenProv 1, KRAS Exon 3
200-bp Prov 2, KRAS Exon 3
amplikonProv 3, KRAS Exon 3
DNA-storleksmarkör
Okluven
200-bp
amplikon
DHPLCavrinning
Figur 5B
Q61H ger
65- och 135-bpfragment
KRAS Control Wild-Type
KRAS Control Exon 3
OkluvenProv 1, KRAS Exon 3
200-bp Prov 2, KRAS Exon 3
amplikonProv 3, KRAS Exon 3
DNA-storleksmarkör
Okluven
200-bp
amplikon
Figurerna 5A och 5B: WAVE DHPLC-analys med UV-detektion (figur 5A) och
fluorescensdetektion (figur 5B) av SURVEYOR Nuclease-nedbrytning av KRAS Positive
Control Exon 3 och KRAS Control Wild-Type samt CRC DNA som isolerats från FFPEsektioner. Vid visuell granskning av kromatogrammen ska de nedbrutna proverna jämföras med
Wild-Type Control (brun linje). KRAS Positive Control Exon 3 (grön linje) är en blandning av WildType och muterade Q61H-plasmider som ger nedbrytningstoppar på 65 och 135 bp; denna
kontroll visar att nedbrytningsmomentet i SURVEYOR Nuclease fungerar och visar det område i
kromatografen som bör undersökas visuellt för att fastställa om ett prov ska skickas för DNAsekvensanalys. När nedbrytningsmönster jämförs för proverna 1-3 med Wild-Type ej nedbrutet
kromatogram är det uppenbart att prov 2 (svart linje) har en sannolik mutation och bör
sekvenseras för att bekräfta förekomst eller frånvaro av en mutation i relevant kodon. Prov 1 och 3
(blå och röda linjer) har liknande kromatogram som de som observeras för Wild-Type Control och
behöver inte skickas för DNA-sekvensanalys. Observera att sekvenseringsresultatet är det
definitiva resultatet eftersom det kan finnas andra ej relevanta mutationer som kan ge samma
fregmentstorlekar.
Bruksanvisning för CRC RAScan Combination Kit med DHPLC-system
Sid. 23
14 Tolkning av resultat
Figur 6A
DHPLCgenomflöde
K117N ger
80- och 88-bpfragment
DHPLCKRAS Control Wild-Type
avrinning
KRAS Control Exon 4A
OkluvenProv 1, KRAS Exon 4A
200-bp Prov 2, KRAS Exon 4A
amplikonDNA-storleksmarkör
Okluven
168-bp
amplikon
DHPLCavrinning
Figur 6B
K117N ger
80- och 88-bpfragment
DHPLCKRAS Control Wild-Type
avrinning
KRAS Control Exon 4A
OkluvenProv 1, KRAS Exon 4A
200-bp Prov 2, KRAS Exon 4A
amplikonDNA-storleksmarkör
Okluven
168-bp
amplikon
Figurerna 6A och 6B: WAVE DHPLC-analys med UV-detektion (figur 6A) och
fluorescensdetektion (figur 6B) av SURVEYOR Nuclease-nedbrytning av KRAS Positive
Control Exon 4A och KRAS Control Wild-Type och CRC DNA som isolerats från FFPEsektioner. Vid visuell granskning av kromatogrammen ska de nedbrutna proverna jämföras med
Wild-Type Control (grön linje). KRAS Positive Control Exon 4A (blå linje) är en blandning av WildType och muterade K117N-plasmider som ger nedbrytningstoppar på 80 och 88 bp; denna kontroll
visar att nedbrytningsmomentet i SURVEYOR Nuclease fungerar och visar det område i
kromatografen som bör undersökas visuellt för att fastställa om ett prov ska skickas för DNAsekvensanalys. När nedbrytningsmönster jämförs för proverna 1 och 2 med Wild-Type ej
nedbrutet kromatogram är det uppenbart att prov 1 (röd linje) har en sannolik mutation och bör
sekvenseras för att bekräfta förekomst eller frånvaro av en mutation i relevant kodon. Prov 2 (svart
linje) har liknande kromatogram som de som observeras för Wild-Type Control och behöver inte
skickas för DNA-sekvensanalys. Observera att sekvenseringsresultatet är det definitiva resultatet
eftersom det kan finnas andra ej relevanta mutationer som kan ge samma fregmentstorlekar.
Bruksanvisning för CRC RAScan Combination Kit med DHPLC-system
Sid. 24
14 Tolkning av resultat
Figur 7A
DHPLCgenomflöde
Okluven
194-bp
amplikon
DHPLCKRAS
Control Wild-Type
avrinning
KRAS Control Exon 4B
OkluvenProv 1, KRAS Exon 4B
200-bp Prov 2, KRAS Exon 4B
amplikonProv 3, KRAS Exon 4B
DNA-storleksmarkör
DHPLCavrinning
A146T ger
78- och 116-bpfragment
Figur 7B
A146T ger
78- och 116-bpfragment
DHPLCKRAS
Control Wild-Type
avrinning
KRAS Control Exon 4B
OkluvenProv 1, KRAS Exon 4B
200-bp Prov 2, KRAS Exon 4B
amplikonProv 3, KRAS Exon 4B
DNA-storleksmarkör
Okluven
194-bp
amplikon
Figurerna 7A och 7B: WAVE DHPLC-analys med UV-detektion (figur 7A) och
fluorescensdetektion (figur 7B) av SURVEYOR Nuclease-nedbrytning av KRAS Positive
Control Exon 4B och KRAS Control Wild-Type och CRC DNA som isolerats från FFPEsektioner. Vid visuell granskning av kromatogrammen ska de nedbrutna proverna jämföras med
Wild-Type Control (brun linje). KRAS Positive Control Exon 4B (mörkgrön linje) är en blandning av
Wild-Type och muterade A146T-plasmider som ger nedbrytningstoppar på 78 och 116 bp; denna
kontroll visar att nedbrytningsmomentet i SURVEYOR Nuclease fungerar och visar det område i
kromatografen som bör undersökas visuellt för att fastställa om ett prov ska skickas för DNAsekvensanalys. När nedbrytningsmönster jämförs för proverna 1 — 3 med Wild-Type ej nedbrutet
kromatogram är det uppenbart att prov 3 (röd linje) har en sannolik mutation och bör sekvenseras
för att bekräfta förekomst eller frånvaro av en mutation i relevant kodon. Prov 2 och 3 (svarta och
ljusgröna linjer) har liknande kromatogram som de som observeras för Wild-Type Control och
behöver inte skickas för DNA-sekvensanalys. Observera att sekvenseringsresultatet är det
definitiva resultatet eftersom det kan finnas andra ej relevanta mutationer som kan ge samma
fregmentstorlekar.
Bruksanvisning för CRC RAScan Combination Kit med DHPLC-system
Sid. 25
14 Tolkning av resultat
Figur 8A
NRAS Control Wild-Type
NRAS Control Exon 2
OkluvenProv 1, NRAS Exon 2
200-bp Prov 2, NRAS Exon 2
amplikonDNA-storleksmarkör
DHPLCgenomflöde
G12D ger
88- och 148-bpfragment
Okluven
236-bp
amplikon
DHPLCavrinning
Figur 8B
G12D ger
88- och 148-bpfragment
NRAS Control Wild-Type
NRAS Control Exon 2
OkluvenProv 1, NRAS Exon 2
200-bp Prov 2, NRAS Exon 2
amplikonDNA-storleksmarkör
Okluven
236-bp
amplikon
Figurerna 8A och 8B: WAVE DHPLC-analys med UV-detektion (figur 8A) och
fluorescensdetektion (figur 8B) av SURVEYOR Nuclease-nedbrytning av NRAS Positive
Control Exon 3 och Wild-Type-Controls samt CRC DNA som isolerats från FFPE-sektioner.
Vid visuell granskning av kromatogrammen ska de nedbrutna proverna jämföras med NRAS
Control Wild-Type (blå linje). NRAS Positive Control Exon 2 (grön linje) är en blandning av WildType och muterade G12D-plasmider som ger nedbrytningstoppar på 88 och 148 bp; denna
kontroll visar att nedbrytningsmomentet i SURVEYOR Nuclease fungerar och visar det område i
kromatografen som bör undersökas visuellt för att fastställa om ett prov ska skickas för DNAsekvensanalys. När nedbrytningsmönster jämförs för proverna 1 och 2 med Wild-Type nedbrutet
kromatogram är det uppenbart att prov 1 (röd linje) har en sannolik mutation och bör sekvenseras
för att bekräfta förekomst eller frånvaro av en mutation i relevant kodon. Prov 2 (svart linje) har
liknande kromatogram som de som observeras för NRAS Control Wild-Type och behöver inte
skickas för DNA-sekvensanalys. Observera att sekvenseringsresultatet är det definitiva resultatet
eftersom det kan finnas andra ej relevanta mutationer som kan ge samma fregmentstorlekar.
Bruksanvisning för CRC RAScan Kit med DHPLC-system
Sid. 26
14 Tolkning av resultat
Figur 9A
NRAS Control Wild-Type
NRAS Control Exon 3
OkluvenProv 1, NRAS Exon 3
200-bp Prov 2, NRAS Exon 3
amplikonDNA-storleksmarkör
DHPLCgenomflöde
DHPLCavrinning
Q61K ger
78- och 125-bpfragment
Okluven
203-bp
amplikon
Figur 9B
NRAS Control Wild-Type
NRAS Control Exon 3
OkluvenProv 1, NRAS Exon 3
200-bp Prov 2, NRAS Exon 3
amplikonDNA-storleksmarkör
Q61K ger
78- och 125bpfragment
Okluven
203-bp
amplikon
Figurerna 9A och 9B: WAVE DHPLC-analys med UV-detektion (figur 9A) och
fluorescensdetektion (figur 9B) av SURVEYOR Nuclease-nedbrytning av NRAS Positive
Control Exon 3 och Wild-Type-Controls samt CRC DNA som isolerats från FFPE-sektioner.
Vid visuell granskning av kromatogrammen ska de nedbrutna proverna jämföras med NRAS
Control Wild-Type (grön linje). NRAS Positive Control Exon 3 (blå linje) är en blandning av WildType och muterade Q61K-plasmider som ger nedbrytningstoppar på 78 och 125 bp; denna
kontroll visar att nedbrytningsmomentet i SURVEYOR Nuclease fungerar och visar det område i
kromatografen som bör undersökas visuellt för att fastställa om ett prov ska skickas för DNAsekvensanalys. När nedbrytningsmönster jämförs för proverna 1 och 2 med Wild-Type ej
nedbrutet kromatogram är det uppenbart att prov 1 (röd linje) har en sannolik mutation och bör
sekvenseras för att bekräfta förekomst eller frånvaro av en mutation i relevant kodon. Prov 2 (svart
linje) har liknande kromatogram som de som observeras för NRAS Control Wild-Type och behöver
inte skickas för DNA-sekvensanalys. Observera att sekvenseringsresultatet är det definitiva
resultatet eftersom det kan finnas andra ej relevanta mutationer som kan ge samma
fregmentstorlekar.
Bruksanvisning för CRC RAScan Combination Kit med DHPLC-system
Sid. 27
14 Tolkning av resultat
Figur 10A
DHPLCgenomflöde
NRAS Control Wild-Type
NRAS Control Exon 4
OkluvenProv 1, NRAS Exon 4
200-bp Prov 2, NRAS Exon 4
amplikonDNA-storleksmarkör
Okluven
233-bp
amplikon
DHPLCavrinning
A146T ger
68- och 165-bpfragment
Figur 10B
A146T ger
68- och 165-bpfragment
NRAS Control Wild-Type
NRAS Control Exon 4
OkluvenProv 1, NRAS Exon 4
200-bp Prov 2, NRAS Exon 4
amplikonDNA-storleksmarkör
Okluven
233-bp
amplikon
Figurerna 10A och 10B: WAVE DHPLC-analys med UV-detektion (figur 10A) och
fluorescensdetektion (figur 10B) av SURVEYOR Nuclease-nedbrytning av NRAS Positive
Control Exon 4 och Wild-Type Controls samt CRC DNA som isolerats från FFPE-sektioner.
Vid visuell granskning av kromatogrammen ska de nedbrutna proverna jämföras med NRAS
Control Wild-Type (grön linje). NRAS Positive Control Exon 4 (blå linje) är en blandning av WildType och muterade A146T-plasmider som ger nedbrytningstoppar på 68 och 165 bp; denna
kontroll visar att nedbrytningsmomentet i SURVEYOR Nuclease fungerar och visar det område i
kromatografen som bör undersökas visuellt för att fastställa om ett prov ska skickas för DNAsekvensanalys. Vid jämförelse mellan nedbrytningsmönster för prover 1 och 2 med Wild-Type
nedbrutna kromatogram, är det tydligt att kromatogrammen för proverna 1 och 2 (röda och svarta
linjer) liknar det som observerats för NRAS Control Wild-Type och de behöver inte skickas till
DNA-sekvensanalys. Observera att sekvenseringsresultatet är det definitiva resultatet för ett
positivt SURVEYOR Scan-resultat, eftersom det kan finnas andra ej relevanta mutationer som kan
ge samma fregmentstorlekar.
Bruksanvisning för CRC RAScan Combination Kit med DHPLC-system
Sid. 28
15 Prestationsegenskaper
15 Prestationsegenskaper
15.1 LOD för mutationer med SURVEYOR Scan-kit
Validering av SURVEYOR Scan-kitten för DHPLC-plattformar med användning av plasmidkloner
av alla indicerade mutationer har visat att SURVEYOR Nuclease-toppar kan detekteras i en
blandning av 2-5% mutation i en Wild-Type-bakgrund.
Automatiserad sekvenseringsbestämning av både framåt och bakåt-strängar misslyckas ofta med
att detektera mutationer i blandningar med mindre än 10% Wild-Type-DNA. Tillsammans med
resultaten från SURVEYOR Nuclease är det möjligt att med högre säkerhet tolka kromatogram om
5-10% för mutant sekvensering.
Om analysen visar ett positivt SURVEYOR Scan-resultat, men utan detekterbar KRAS- eller
NRAS-mutation med DNA-sekvensering, rekommenderar vi att resultatet "Ingen avvikelse
detekterad" registreras. Ytterligare detaljer finns i avsnittet Att tänka på avseende
arbetsflödet.
15.2 Sekvensbekräftelse
Fortsätt med sekvensbekräftelse för alla positiva SURVEYOR Scan-resultat för att fastställa
sekvensidentiteten för KRAS eller NRAS Exons 2, 3 eller 4-mutationer. Figur 11 är ett exempel på
vikten av sekvensbekräftelse för att fastställa exakt mutation.
Fortsätt inte med sekvensbekräftelse om SURVEYOR Scan-resultatet var negativt. Provet kan
rapporteras som Wild-Type eller ingen avvikelse detekterad.
Universal Sequencing Primers som inkluderas i kittet är avsedda för sekvensbekräftelse.
Framåtprimer är PN 710153F (Universal Sequencing Primer 1) och bakåtprimer är PN 710153R
(Universal Sequencing Primer 2).
Prov 1: G13C
Prov 2: G13D
Figur 11 Sekvensanalys av prover med samma KRAS Exon 2 SURVEYOR Nuclease
nedbrytningsmönster. Proverna 1 och 2 ovan visade samma DHPLC-toppmönstwer efter
SURVEYOR Nuclease-nedbrytning och analyserades vidare med DNA-sekvensering.
Sekvenseringen visade det är två olika mutationer; G13C och G13D. Dessa prover illustrerar (a)
förmågan hos SURVEYOR Nuclease att detektera potentiella mutationer men (b) inte fastställa
exakt placering eller specifik basförändring hos mutation(erna) i provet.
Obs! Det är viktigt att kontrollera att ingen "stämpel"-sekvens förekommer i varje sekvenserings
kromatogram för att bekräfta att mutationen inte beror på att provet kontaminerats av en av kittets
kontroller.
Obs! Om provet är Wild-Type vid relevanta kodon av intresse och den "stämplade" sekvensen
förekommer, är provet kontaminerat och analysen måste göras om. Förekomst av "stämpeln"
anger att provet kan vara kontaminerat med en av kittets Wild-Type-Controls. Denna
kontamination kan maskera eventuell lågnivåmutation i provet. Se A.2 Kontrollernas DNAstämplar för information om kontrollernas stämpelsekvenser.
Bruksanvisning för CRC RAScan Kit med DHPLC-system
Sid. 29
15 Prestationsegenskaper
15.3 Analysprocessens begränsningar
Kontaminerande ämnen som överförs genom extraktion av formalinfixerade paraffininbäddade
prover kan inverka negativt på PCR-amplifieringen och nedbrytningsprocessen med SURVEYOR
Nuclease. Rutinerna för kvalitetskontroll som beskrivs under Kvalitetskontroll av PCR-produkter
säkerställer att extraherad DNA är lämplig för användning i detta kit.
Detta kit har validerats för analys av formalinfixerade paraffininbäddade kolorektala
cancertumörprover. Det har inte validerats för diagnostisk användning med andra cancertyper eller
med färska eller frysta biopsiprover.
Läs i Bilaga B - Felsökningsguide, nedan, för felsökning av onormala resultat och information
om faktorer som kan påverka analysen.
Försiktighet måste iakttas för att undvika överföring och korskontamination med detta kit. På grund
av analysmetodens extrema känslighet, måste försiktighetsåtgärder vidtas vid följande punkter:

Se till att alla prover hanteras på ett sådant sätt att korskontamination mellan prover inte
kan förekomma

Arbeta i en PCR-arbetsstation eller annat lämpligt utrymme där arbetsområdet kan
utsättas för UV-ljus innan PCR-amplifieringsreaktionerna ställs in.

Använd en separat PCR-arbetsstation eller ett separat rum för att öppna proverna efter
PCR-amplifiering för kvalitetskontroll med gelelektrofores.

Förberedelse för SURVEYOR Nuclease-nedbrytning bör göras i ett separat rum eller på
en annan PCR-arbetsstation än den arbetsstation där inledande PCR ställdes in.

Se till att kittets plasmidkontroller hanteras separat från testproverna under alla stadier i
analysen.

o
Kontrollera att alla lösningar, kontroll utan templat, samt prov-DNA-brunnar är
förslutna innan rören med kontrollplasmid-DNA öppnas.
o
KONTROLLER SKA HANTERAS SIST. Tillsätt kontrollplasmid-DNA till relevanta
rör först EFTER DET ATT ALLA kontroller utan templat och provbrunnar har
förslutits.
o
När kontroll-DNA-rören har förslutits ska ALLA rör och lock torkas av med ett
medel som utplånar DNA (t.ex. 10% blekmedel) innan de överförs till ett annat
område.
Se till att pipettering av prover i plattor med 96 brunnar inte möjliggör provkontamination
av intilliggande brunnar på grund av stänk vid blandningen eller på grund av att
pipettspetsarna inte bytts ut.
Bruksanvisning för CRC RAScan Kit med DHPLC-system
Sid. 30
Bilaga A
Bilaga A
A.1 Översikt av platta för SURVEYOR Scan kit
Den översikt av plattan som föreslås nedan är för SURVEYOR Scan-analys för alla sju KRAS och
NRAS Exons samtidigt i 10 prover.
Förklaring: Ex = Exon; WT = Wild-Type; Mut = Mutation; NTC = No Template Control (kontroll
utan templat)
A.2 Kontrollernas DNA-stämplar
Sekvenserna med en "stämpel" anges nedan.
Förklaring: De vanligaste mutationsområdena markeras med lila. Sekvenser med
VERSALER är kodande baser; ej kodande baser anges med gemener.
Kontrollernas genetiska "stämpel" är markerad i gult; denna avvikelse från KRAS eller
NRAS Wild-Type-sekvensen, i en region som inte förväntas ha mutationer, kan
användas för att felsöka provkontamination av Positive Controls. Se Bilaga B Felsökningsguide, problem 8, för ett exempel på en SURVEYOR Scan-kurva av
sådan kontamination.
KRAS Exon 2-"stämpel"
Amplikonstorlek: 190 bp. För att skapa KRAS Exon 2-kontrollplasmidens genetiska stämpel
har TAT ändrats till ATA. Kodon 12 och 13 har också markerats nedan.
GCTGGTGGCGTAGGCAAGAGTGCCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAAATAGAT
KRAS Exon 3-"stämpel"
Amplikonstorlek: 200 bp. För att skapa KRAS Exon 3-kontrollplasmidens genetiska stämpel
har ACC ändrats till TGG. Kodon 59 och 61 har också markerats nedan.
GAATGGTGTCTCTTGGATATTCTCGACACAGCAGGTCAAGAG
KRAS Exon 4A-"stämpel"
Amplikonstorlek: 168 bp. För att skapa KRAS Exon 4A-kontrollplasmidens genetiska stämpel
har AGA ändrats till TCT. Kodon 117 har också markerats nedan.
AATAAATGTGATTTGCCTTCTAGAACAGTTCTCAC
Bruksanvisning för CRC RAScan Combination Kit med DHPLC-system
Sid. 31
Bilaga A
KRAS Exon 4B-"stämpel"
Amplikonstorlek: 194 bp. För att skapa KRAS Exon 4B-kontrollplasmidens genetiska stämpel
har agt ändrats till tca. Kodon 146 har också markerats nedan.
TCAGCAAAGACAAGACAGgtatcaaac
NRAS Exon 2-"stämpel"
Amplikonstorlek: 236 bp. För att skapa NRAS Exon 2-kontrollplasmidens genetiska stämpel
har aca ändrats till tgt. Kodon 12 och 13 har också markerats nedan.
ccatgtggttcttgctggtgtgaaATGACTGAGTACAAACTGGTGGTGGTTGGAGCAGGTGGTGTT
NRAS Exon 3-"stämpel"
Amplikonstorlek: 203 bp. För att skapa NRAS Exon 3-kontrollplasmidens genetiska stämpel
har GAC ändrats till CTG. Kodon 59 och 61 har också markerats nedan.
ACAGCTGGACAAGAAGAGTACAGTGCCATGAGACTGCAA
NRAS Exon 4-"stämpel"
Amplikonstorlek: 233 bp. För att skapa NRAS Exon 4-kontrollplasmidens genetiska stämpel
har CAA ändrats till GTT. Kodon 117 och 146 har också markerats nedan.
AACAAGTGTGATTTGCCAACAAGGACAGTTGATACAAAAGTTGCCCACGAACTGGCCAAGAGTTACGGG
ATTCCATTCATTGAAACCTCAGCCAAG
A.3 Systemkrav för denaturering med HPLC (DHPLC)
A.3.1 DHPLC-specifikationer för SURVEYOR SCAN-användningar
Följande specifikationer är minimikrav för DHPLC-systemets specifikationer för att utföra analyser
med SURVEYOR Scan KRAS- och NRAS-kittet.
Tillförselsystem för högpresterande gradientlösning
 Binär gradient kapacitet; högtryck eller lågtryck
 Flödeshastighetskontroll, minsta område: 0,7 – 1,6 mL/min
 Flödeshastighet: ± 2% (H2O vid 20 ºC)
 Lösningsavgasare
Autoprovtagare
 Temperaturkontroll för kylning av plattor, inställningsbar: 4 till 14 ºC
 Injektionsvolym: 5–50 µL
Separationskassett
 Utformad för separation av dsDNA-fragmentstorlek, fragmentstorlekar 50 till 250 bp
Ugn med temperaturkontroll med hög precision
 Temperaturområde: 40 till 70 ºC
 Temperaturprecision: ± 0,2 ºC
 Temperatur-reproducerbarhet: ± 0,2 ºC
 Linjäritet över hela temperaturområdet: ± 2,0 ºC
Detektionsalternativ 1
 UV-/VIS-detektor
 Område för våglängd: 190-700 nm
 UV-källa: Deuteriumlampa
Detektionsalternativ 2
 Fluorescensdetektor
 Område för våglängd: excitation: 200-85 nm; emission: 250-900 nm
 Fluorescenskälla: 150 W xenonlampa

Pump för fluorescerande färg
Bruksanvisning för CRC RAScan Combination Kit med DHPLC-system
Sid. 32
Bilaga A


Fast flödeshastighet vid 0,1 mL/min – 20%/+50%
Lågt pulsationsflöde
A.3.2 Systemdrift
För inställning och drift av DHPLC-systemet, läs och följ tillverkarens rekommendationer för analys
av dsDNA-fragment i storleksområdet 50 bp till 250 bp, med inriktning på storleksurskiljning om 10
bp eller bättre. Detta är storleksområdet för fragment efter SURVEYOR Nuclease-nedbrytning
med användning av detta kit.
För föreslagna gradientinställningar för DHPLC-system för analys av SURVEYOR Nucleasenedbrytningar, besök http://world.transgenomic.com/diagnostic-tools/genetic-analysis-kits/crcrascan-kits-eu/dhplcsystemsettings.
A.3.3 Underhåll av DHPLC-kassetter
Följ tillverkarens anvisningar beträffande underhåll av DHPLC-kassetter.
Obs! Analys av SURVEYOR Nuclease-reaktioner kräver mer frekventa och striktare
rengöringsprotokoll än de som används för vanlig PCR-analys. Läs i riktlinjerna för ditt DHPLCsystem för mer information.
A.4 Laboratorieinstallation för PCR-analyser
För tillförlitliga och kontaminationsfria PCR-resultat ska god laboratoriesed iakttas när PCRlaboratoriet utformas.
När laboratoriet planeras ska behovet av avstånd mellan förberedelse för PCR-amplifiering och
aktiviteter efter amplifiering beaktas. Det är viktigt att separera (i) DNA-isolering: (ii) PCRamplifiering; och (iii) aktiviteter efter PCR, t.ex. att öppna amplifierade prover vid förberedelse för
att köra geler och förbereda andra analyser, t.ex. SURVEYOR Nuclease-nedbrytningar och DNAsekvensering.
Det är också viktigt att laboratorieutrustning och material tilldelas varje område och att de endast
används i det specifika området. Genom att torka av ytorna med 10 % (v/v) blekmedel, som
blandas varje vecka, kommer underlättas eliminering av DNA-fragment ≤ 500 bp som templat för
PCR. Det kan vidare vara gynnsamt att behandla plastmaterial och lösningar med UV-ljus med
kort våglängd i 7-10 minuter med användning av en UV-korslänkare.
Obs! Enzymer och DNA som ska amplifieras får inte UV-behandlas.
Genom att använda lämplig skyddsutrustning, byta handskar ofta samt torka av handskbeklädda
händer med 10 % (v/v) blekmedel före inträde i en arbetsstation kommer att var till stor hjälp för att
reducera risken för kontamination.
Det bör minst finnas ett arrangemang som liknar det tvårumsarrangemang som visas i
nedanstående diagram som är specifikt utformat för PCR och analys med SURVEYOR Nuclease.
Bruksanvisning för CRC RAScan Combination Kit med DHPLC-system
Sid. 33
Bilaga A
Bruksanvisning för CRC RAScan Combination Kit med DHPLC-system
Sid. 34
Bilaga A
A.5 Litteraturlista
1. Amgen News Release (2013) New analyses identify predictive biomarkers for Vectibix
(panitumumab) in patients with metastatic colorectal cancer.
http://wwwext.amgen.com/media/media_pr_detail.jsp?-year=2013&releaseID=1820728
®
2. Peeters M et al (2013) Massively parallel tumor multigene sequencing to evaluate
response to panitumumab in a randomized phase III study of metastatic colorectal cancer.
Clin Cancer Res. 19 1902-12.
3. De Roock W et al (2010) Association of KRAS p.G13D mutation with outcome in patients
with chemotherapy-refractory metastatic colorectal cancer treated with cetuximab. JAMA
304 1812-20.
4. Peeters M et al (2013) Mutant KRAS codon 12 and 13 alleles in patients with metastatic
colorectal cancer: assessment as prognostic and predictive biomarkers of response to
panitumumab. J Clin Oncol. 31 759-65.
5. Andre T et al (2013) Panitumumab combined with irinotecan for patients with KRAS wildtype metastatic colorectal cancer refractory to standard chemotherapy: a GERCOR
efficacy, tolerance, and translational molecular study. Ann Oncol. 24 412-9.
6. Loupakis F et al (2009) KRAS codon 61, 146 and BRAF mutations predict resistance to
cetuximab plus irinotecan in KRAS codon 12 and 13 wild-type metastatic colorectal
cancer. Br J Cancer 101 715-21.
7. De Roock W et al (2010) Effects of KRAS, BRAF, NRAS, and PIK3CA mutations on the
efficacy of cetuximab plus chemotherapy in chemotherapy-refractory metastatic colorectal
cancer: a retrospective consortium analysis. Lancet Oncol. 11 753-62.
8. Qiu P et al (2004) Mutation detection using Surveyor™ nuclease. Biotechniques 36 702707
9. Kuang Y et al (2009) Noninvasive detection of EGFR T790M in gefitinib or erlotinib
resistant non-small cell lung cancer. Clin. Cancer Res. 15 2630-6
10. Mitani N et al (2007) Surveyor nuclease-based detection of p53 gene mutations in
haematological malignancy. Ann. Clin. Biochem. 44 557-9
11. Engelman JA et al (2006) Allelic dilution obscures detection of a biologically significant
resistance mutation in EGFR-amplified lung cancer. J. Clin. Invest. 116 2695-2706
Se även http://world.transgenomic.com/files/literature/482146.pdf
SURVEYOR Nuclease och dess tillämpningar.
Bruksanvisning för CRC RAScan Combination Kit med DHPLC-system
för
referenser
om
Sid. 35
Bilaga B
Bilaga B
Felsökningsguide
Effektiv användning av SURVEYOR Scan kit för DHPLC är beroende av att ett antal olika steg
genomförs framgångsrikt. Ett av de mest avgörande stegen är PCR-amplifiering som måste
resultera i produktion av specifika, jämnstora DNA i tillräcklig kvantitet för att kunna detekteras
efter hybridisering och klyvning. Detta beror i sin tur på kvaliteten på det ursprungliga provet. Att
utföra analysen med DNA som inte motsvarar kvalitetsvillkoren avseende kvalitet och kvantitet
rekommenderas inte.
Obs! Om det är första gången du använder SURVEYOR Nuclease ska du utföra experimenten i
avsnittet Använda kontrollplasmid-DNA efter det att du har läst och förstått avsnittet Stegvisa
anvisningar. Se till att du har resultaten från kontrollplasmid-DNA innan du kontaktar
Transgenomics tekniska support.
Denna felsökningsguide omfattar en rad problem som du kan komma att stöta på medan du
använder SURVEYOR Scan-kitter för DHPLC samt förslag på hur du kan lösa dem. De exempel
som visas kommer från både KRAS och NRAS Exons.
Läs i instrumenthandboken för DHPLC-systemet för detaljerad information om användning och
underhåll av instrumentet. Handboken innehåller specifika processer för att kontrollera och
underhålla kolumnprestation och inkluderar felsökningsinformation.
Problem 1 – Låg PCR-avkastning eller avsaknad av PCR-produkt vid analys
på agarosgel
LÅG PCRAVKASTNING
God
Dålig
PCRPCRavkastningavkastning
MÖJLIG ORSAK
LÖSNING
Dålig kvalitet på DNAtemplat
Gör om reningen av DNA; gå igenom den
använda reningsmetoden Om FFPEextraherat material är alltför fragmenterat
kan alternativa FFPE-block behövas.
För mycket RNA i provet
som orsakar att DNAkoncentrationen
beräknas för högt
Upprepa RNase-behandlingen av DNAprovet och upprepa DNA-reningen.
Termocyklern är inte
kalibrerad
Kalibrera termocyklern.
Otillräckligt med templat
Öka mängden templat.
RNAband
Obs! Högkvalitativ DNA från FFPE ska användas. DNA bör ha en koncentration på 25 ng/µL
enligt bestämning genom absorption av 260 nm, ha en absorptionsgrad vid 260/280 nm som
överstiger 1,8 samt vara högre än 90% DNA (d.v.s. fritt från den mesta tRNA- och rRNAkontaminationen enligt visuell bedömning på agarosgel). Förvara DNA-prover vid en
temperatur mellan -20 °C och -80 °C.
Analys av DNA-templat som extraherats från paraffininbäddad vävnad kräver iakttagande av ett
flertal försiktighetsåtgärder. Extraherat DNA kan behandlas med uracil DNA-glykosylas för att
förebygga amplifiering av DNA-fragment som innehåller deaminerade C-rester. En hög
procentandel av det A260-absorberande material som extraheras från paraffininbäddad vävnad
kommer ofta inte att amplifieras väl under PCR. Genom att använda en större mängd DNA till
starten kan man ofta producera en tillräcklig mängd med amplifieringsprodukt. En annan sak att
tänka på är att välja FFPE-tumörsektioner med en hög andel tumörceller. Mikrodissektion kan
också användas, men detta är tidskrävande och torde inte rekommenderas vid generell
laboratorietestning.
Bruksanvisning för CRC RAScan Combination Kit med DHPLC-system
Sid. 36
Bilaga B
Problem 2 – Flera PCR-produkter vid analys på agarosgel
FLERA PCR-PRODUKTER
God
PCRavkastning
MÖJLIG ORSAK
LÖSNING
För låg härdningstemperatur
Kontrollera termocyklerns
kalibrering.
Flera
PCRband
Obs! PCR ska producera en tillräckligt stor avkastning (>20 ng/µL) av EN ENSTAKA amplifierad
typ av korrekt storlek. DNA Polymerase och DNA Polymerase 10X PCR Buffer som
tillhandahålls i detta kit måste användas för PCR. Amplikoner från kontroller ska brytas ned
med SURVEYOR Nuclease och köras för att utesluta falska bakgrundsstörningar genom visuell
jämförelse av kromatogramprofiler (se Exempel på resultat, figurer 4-10).
Bruksanvisning för CRC RAScan Combination Kit med DHPLC-system
Sid. 37
Bilaga B
Problem 3 – Inga klyvningsprodukter observeras vid analysen efter
behandling av heteroduplex med SURVEYOR Nuclease
INGA KLYVNINGSPRODUKTER
Position
för saknade
heteroduplex
MÖJLIG ORSAK
LÖSNING
Andelen
avvikande mål är
för liten
Kontrollera
analysprocessen
genom att använda
kontrollsubstanserna.
Ineffektiv
formering av
heteroduplex
Följ korrekt PCR- och
hybridiseringsprocess.
Använd nyss
hybridiserad DNA vid
SURVEYOR
Nucleasenedbrytning.
Utför nya PCRamplifiering med
genom att (1)
använda samma
kvantitet DNAtemplat; (2) öka
mängden start-DNA;
eller (3) isolera färsk
DNA från samma eller
en annan FFPEsektion.
Ej beskuren
homoduplextopp
Overksam
SURVEYOR
Nuclease
Utför Positive Controlreaktion för att
kontrollera
enzymfunktionen.
Använd endast färska
SURVEYOR
Nuclease Master Mixblandningar.
Obs! SURVEYOR Nuclease klyver huvudsakligen avvikelser i heteroduplex. Andelen
heteroduplex i förhållande till homoduplex i det hybridiserade provet avgör storleken på
SURVEYOR Nuclease-nedbrytningssignal. Om KRAS- eller NRAS-mutationen förekommer i
väldigt låga koncentrationer i det genomiska DNA-provet, kan signalen vara för svag för att ge ett
positivt resultat.
Det är viktigt att se till att hybridiseringssteget ingår i termocykelprogrammet (se
Amplifieringsprotokoll) för att maximera effektiviteten i heteroduplexformationen. Heteroduplex
är väldigt ineffektivt formade under vanliga PCR-reaktioner.
Obs! Förhållandet mellan signal och bakgrundsstörningar är normalt tillräckligt högt för att
detektera mutationer som förekommer i en liten andel av de totala DNA-templaten. Det är möjligt
att detektera 1 till 2% av muterat DNA. Figurer 4-10 visar nedbrytningsprodukter som genereras
med homoduplex och heteroduplex KRAS och NRAS Positive Control-DNA (inkluderas i detta kit)
samt FFPE-prover på ett WAVE DHPLC 4500-system. Klyvningsprodukterna syns tydligt som två
nya toppar eluerande med de förväntade storlekar som kan beräknas i förhållande till DNAstorleksmarkören.
Bruksanvisning för CRC RAScan Kit med DHPLC-system
Sid. 38
Bilaga B
Varning! Kommersiellt tillgängliga PCR-buffertar varierar kraftigt när det gäller innehåll och
sammansättningen anges ofta inte av leverantörerna. Ett flertal buffertar är INTE kompatibla med
SURVEYOR Nuclease på grund av pH-värdet eller förekomsten av tillsatser, ytaktiva ämnen eller
andra skyddade ingredienser. ANVÄND INTE någon annan polymeras eller 10X
polymerasbuffert än de som tillhandahålls i detta kit.
Problem 4 – Höga bakgrundsstörningar efter behandling med SURVEYOR
Nuclease
HÖGA BAKGRUNDSSTÖRNINGAR
MÖJLIG ORSAK
LÖSNING
Undermåligt
hybridiseringssteg
Gör så här:
1. Se till att DNAkoncentrationen är i en
nivå >25 ng/µL.
2. Upprepa steget med
heteroduplex formering
och var noga med att
följa rekommenderad
process; se 12.7.1.
DHPLCgenomflöde
Prov
med mycket
störningar
i bakgrunden
DHPLCtvätt
Mängden DNA är för
låg
Kontrollera avkastning och
kvalitet på DNA-templat
Obestämda PCRprodukter
Kontrollera avkastning och
kvalitet på DNA-templat
SURVEYOR
Enhancer W2
och/eller
SURVEYOR
Enhancer Cofactor
har förlorat verkan
Kontrollera kittets
utgångsdatum
OBS! Det kan hända att SURVEYOR Nuclease rispar dubbelsträngad DNA vid slumpvist
matchade ställen. Detta orsakar störningar efter nedbrytningen. Denna aktivitet dämpas av
SURVEYOR Enhancer W2 och dess Cofaktor utan att ha andra negativa effekter på klyvningen av
avvikelser. SURVEYOR Enhancer W2 och Cofaktor ingår i detta kit och skall alltid användas.
Då denna typ av rispning fortfarande förekommer, genereras mindre toppar på DHPLC-systemet.
Nedbrytningen av Wild Type Control kommer att visa dessa mindre toppar. Denna jämförelse
används för att söka efter skillnader i elektroferogrammönsten mellan Wild-Type Control och
provet och används vid jämförelse av provets mönster med Wild-Type Control.
Bruksanvisning för CRC RAScan Kit med DHPLC-system
Sid. 39
Bilaga B
Problem 5 – Toppar i negativa kontroller med SURVEYOR Nucleasenedbrytning
NEDBRYTNINGSTOPPAR I NEGATIVA
KONTROLLER
Nedbrytningstoppar
med svag signal
i Wild-Typekontroll
DHPLCgenomflöde
Ej beskuren
homoduplextopp
MÖJLIG ORSAK
LÖSNING
Kittets innehåll har
kontaminerats med
KRAS- elller NRASamplikoner eller
plasmidkontroller
Kassera alla
kitkomponenter
och använd ett
nytt kit.
DHPLCtvätt
Kontakta
Transgenomic
tekniska support för
att diskutera
eventuella
anledningar och
källor till
kontaminationen
Problem 6 – Misslyckade SURVEYOR Nuclease-resultat
SURVEYOR NUCLEASE-NEDBRYTNING AV
POSITIVE CONTROLS HAR MISSLYCKATS
Inga tydliga
nedbrytnings
toppar
Ej beskuren
homoduplextopp
MÖJLIG ORSAK
LÖSNING
SURVEYOR
Nuclease tillsattes
inte
Bryt ned ett nytt
prov
SURVEYOR
Nucleasenedbrytning
skedde vid fel
temperatur
Bryt ned ett nytt
prov
Bruksanvisning för CRC RAScan Combination Kit med DHPLC-system
Sid. 40
Bilaga B
Problem 7 – Oväntade toppar i SURVEYOR Nuclease-nedbrytningskurva
SURVEYOR NUCLEASE-NEDBRYTNING AV POSITIVE
CONTROLS HAR MISSLYCKATS
MÖJLIG
ORSAK
Mutation på
ovanlig plats
Oväntad
nedbrytningstopp
DHPLCgenomflöde
Förväntade
nedbrytningstoppar
Ej beskuren
homoduplextopp
LÖSNING
Sekvensera
provet för att
bekräfta
mutationen
DHPLCtvätt
Bruksanvisning för CRC RAScan Kit med DHPLC-system
Sid. 41
Bilaga B
Problem 8 – Proverna kontamineras av Positive Controls
NEDBRYTNINGSMÖNSTER SOM
ÖVERENSSTÄMMER MED FÖREKOMST AV
BLANDADE POSITIVE CONTROLS STÄMPLADE
REGION OCH WILD-TYPE HETERODUPLEX
MÖJLIG ORSAK
Dålig
pipetteringsteknik
Prov 1
Prov 2
Prov 3
LÖSNING
Var försiktig vid
pipettering för att
undvika
korskontamination.
Kontrollera
kontrollstämplarnas
sekvensregioner för
kontamination av
Positive Control.
Sekvenering visar att NRAS Exon 2 stämpelregioner
kontaminerar ett prov.
Kodon 12 och
13
region av
NRAS Exon 2
Plasmidkontrollens
"Stämpel"-region av
NRAS Exon 2
Provet är Wild-Type
Stämpelsekvensen finns
Kontaminerad
Dålig
pipetteringsteknik
Var försiktig vid
pipettering för att
undvika
korskontamination.
Kontrollera
kontrollstämplarnas
sekvensregioner för
kontamination av
Positive Control.
Provet är muterat
Ingen stämpelsekvens
Giltigt prov
Provet är Wild-Type
Ingen stämpelsekvens
finns
Giltigt prov
Bruksanvisning för CRC RAScan Combination Kit med DHPLC-system
Sid. 42
Beställningsinformation
Beställningsinformation
Produktnummer
Produktnamn
Storlek
710104
SURVEYOR Scan KRAS Kit Exon 2 CE IVD
100 reaktioner
710106
SURVEYOR Scan KRAS Kit Exons 3 & 4 CE IVD
100 reaktioner
710400
SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD
100 reaktioner
710077
CRC RAScan Combination Kit
230 reaktioner
Kontaktuppgifter
Huvudkontor
Europa
Transgenomic, Inc.
12325 Emmet Street
Omaha
Nebraska 68164
United States of America
Transgenomic Limited
40 Watt Road
Hillington Park, Hillington
Glasgow G52 4RY
United Kingdom
Tel:
(888) 233-9283* eller +1 (402) 452-5400
Fax:
+1 (402) 452-5401
E-post: [email protected]
Tel:
+44 141 892 8800
Fax:
+44 141 883 5967
E-post: [email protected]
*gäller bara Nordamerika
www.Transgenomic.com
Översättning Ansvarsfriskrivning
Transgenomic, Inc. har gjort allt för att säkerställa riktigheten i denna översättning. Om du har frågor om någon information
i denna översatta version av handboken, se den engelska versionen Instructions for Use for the CRC RAScan™
Combination Kit for DHPLC Systems – 482427(EN) http://world.Transgenomic.com/files/literature/482427(EN).pdf
och / eller kontakt Transgenomic vid [email protected]
Bruksanvisning för CRC RAScan Combination Kit med DHPLC-system
Sid. 43
Varumärken & upphovsrätt
Varumärken & upphovsrätt
SURVEYOR Nuclease: Denna produkt tillverkas med en exklusiv licens under amerikanska patent 6 391 557; 5 869 245;
deras utländska motsvarigheter och andra sökta patent. Användning av SURVEYOR Nuclease kräver licens från
Transgenomic. Utbildnings-, ideella och vinstdrivande organisationer har begränsad rätt att använda SURVEYOR
Nuclease för forskning genom inköp av denna produkt. Återförsäljning eller andra tillämpningar är strängt förbjudna. Var
vänlig kontakta Transgenomic för mer information.
DNA Polymerase: Användning av denna produkt omfattas av ett eller flera av följande patent i US och motsvarande patent
utanför USA:, 5,789,224, 5,618,711, 6,127,155 samt patentanspråk utanför USA motsvarande amerikanskt patent nummer
4,889,818. Köp av denna produkt inkluderar en begränsad, ej överlåtbar immunitet mot intrångsanspråk enligt ovanstående
patent vid användning av endast denna mängd produkt för köparens egna interna forskning. Ingen rättighet under något
annat patent (t.ex. de patenterade 5' nukleasprocessanspråken i de amerikanska patenten 5 210 015 och 5 487 972),
ingen rätt att utföra någon patenterad metod, och ingen rätt att utföra kommersiella tjänster av något slag, inklusive bland
annat rapportering av resultaten av köparens aktiviteter mot avgift eller andra kommersiella överenskommelser, förmedlas
vare sig uttryckligen, underförstått eller på grund av tidigare dispens. Denna produkt är endast avsedd för forskning.
Diagnostisk användning under Roches patent kräver en separat licens från Roche. Ytterligare information om köp av
licenser kan erhållas genom att kontakta Director of Licensing, Applied Biosystems, 850 Lincoln Centre Drive, Foster City,
California 94404, USA.
Transgenomic, SURVEYOR och WAVE är registrerade varumärken och Navigator, CRC RAScan, spirallogotypen samt
Advancing Personalized Medicine är varumärken som tillhör Transgenomic, Inc. Alla övriga varumärken tillhör sina
respektive innehavare.
© 2013 Transgenomic, Inc. Med ensamrätt. Tryckt i USA.
Dokumentnr. 482427(SV) rev-00
Bruksanvisning för CRC RAScan Kit med DHPLC-system
Sid. 44
Download