Inlämningsuppgift Projektkurs i Kemisk Biologi, TFKE39 - IFM

advertisement
Inlämningsuppgift Projektkurs i Kemisk Biologi, TFKE39
Du har fått till uppgift att isolera någon av nedanstående 6 DNA sekvenser som kodar för ett
protein. Genen isoleras från ett cDNA bibliotek och klonas in i en expressionsvektor för att
uttrycka proteinet i E.coli.
Din uppgift blir att göra ett laborationsprotokoll där du beskriver:
Vilket protein kodar DNA sekvensen för?
Ange hur ni kommit fram till vilket protein som avses, vilken databas har ni använt?
Designa primers för amplifiering av genen mha PCR
Konstruera primers för att amplifiera genen utgående från ett cDNA bibliotek, notera 5’ resp
3’ änden samt forward- och reverse primer. Ange hur de ska binda till DNA:t (markera t.ex
med kursivt eller fetstil) Motivera ditt val av primerkonstruktion och hur du valt PCR cykel
för att amplifiera genen.
Isolering av PCR fragment
Ange hur du renar fram PCR fragmentet efter amplifiering.
Val av vektor för expression i E.coli
Motivera ditt val av vektor, utgående från den information du erhållet om proteinets
egenskaper (t.ex stort eller litet protein? , membranprotein eller cytosoliskt?
posttranslationellt modifierat?)
Strategi för kloning av genen in i vald vektor
Hur ska genen klonas in i den valda vektorn? Vilka restriktionsenzymer ska användas? Hur
ska genen uttryckas? Under vilka betingelser ska detta ske (odlingstemperatur,
antibiotikaresistens, induktion med vad?
Chansen att proteinet ska gå att uttrycka i E.coli
Utgående från egenskaper om proteinet (t.ex stort eller litet protein? , membranprotein eller
cytosoliskt? posttranslationellt modifierat?) spekulera om chansen att din konstruktion ska gå
att uttrycka i E.coli
:
Inlämningsuppgiften ska vara skickad till [email protected] senast Tisdagen 19 oktober.
För sent inlämnad uppgift utan motivering kommer inte att läsas.
De som lämnar in för sent får en ny uppgift av mig med ny deadline av mig.
Lasse Mårtensson
IFM-Kemi
[email protected]
Examination: Individuell projektplan omfattande 5-10 sidor som bedöms enligt bifogad
utvärderingsmall med betygsskala (U,3,4,5)
Referenser
Litteratur:

T.A Brown Gene Cloning and DNA analysis, An introduction
Databaser och molekylärbiologi företag:

Expasy proteomics server
http://www.expasy.ch/
Protein Data Bank (3d strukturer av proteiner)
http://www.rcsb.org

NEB cutter On-line program för kontroll av restriktionssites
http://tools.neb.com/NEBcutter2/index.php
Företag som säljer molekylärbiologiska produkter eller tjänster

Stratagene (bl.a. Quikchange för lägesspecifik mutagenes)
http://www.stratagene.com

New England biolabs (NEB) ( bl.a restriktionsenzymer)
http://www.neb.com

Qiagen (bl.a. produkter för rening av DNA, plasmidprep kit)
http://www.qiagen.com

Novagen (bl.a. vektorer för expression av proteiner)
http://www.novagen.com

GATC (utför bl.a. DNA sekvensning
http://www.gatc.de
Välj ett (1) av nedanstående DNA sekvens för kloning och expression i E.coli
A
atgagtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggt
gatgttaatgggcacaaattctctgtcagtggagagggtgaaggtgatgcaacatacgga
aaacttacccttaaatttatttgcactactggaaagctacctgttccatggccaacactt
gtcactactttctcttatggtgttcaatgcttttcaagatacccagatcatatgaaacag
catgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatattttac
aaagatgacgggaactacaaatcacgtgctgaagtcaagtttgaaggtgataccctcgtt
aatagaattgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaa
atggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatgga
atcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagac
cattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattac
ctgtccacacaatctgccctttccaaagatcccaacgaaaagagagatcacatgatcctt
cttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataa
B
atggcttctcatcgtctgctcctcctctgccttgctggactggtatttgtgtctgaggct
ggccctacgggcaccggtgaatccaagtgtcctctgatggtcaaagttctagatgctgtc
cgaggcagtcctgccatcaatgtggccgtgcatgtgttcagaaaggctgctgatgacacc
tgggagccatttgcctctgggaaaaccagtgagtctggagagctgcatgggctcacaact
gaggaggaatttgtagaagggatatacaaagtggaaatagacaccaaatcttactggaag
gcacttggcatctccccattccatgagcatgcagaggtggtattcacagccaacgactcc
ggcccccgccgctacaccattgccgccctgctgagcccctactcctattccaccacggct
gtcgtcaccaatcccaaggaatga
C
atgaactaccccgtgaatcccgacctgatgcccgcgctgatggcggtcttccagcatgtg
cggacgcgcatccagagcgagctcgattgccagcgactcgacctgaccccgcccgacgtc
catgtattgaagcttatcgacgaacaacgcgggctgaacctgcaggacctgggacgccag
atgtgccgcgacaaggcactgatcacccggaagatccgcgagctggagggaagaaacctg
gtccgccgcgagcgcaaccccagcgaccagcgcagcttccagctcttcctcaccgacgag
gggctggccatccaccagcatgcggaggccatcatgtcacgcgtgcatgacgagttgttt
gccccgctcaccccggtggaacaggccaccctggtgcatctcctcgaccagtgcctggcc
gcgcaaccgcttgaggatatttaa
D
atgccccggcgcagcctgcacgcggcggccgtgctcctgctggtgatcttaaaggaacag
ccttccagcccggccccagtgaacggttccaagtggacttattttggtcctgatggggag
aatagctggtccaagaagtacccgtcgtgtgggggcctgctgcagtcccccatagacctg
cacagtgacatcctccagtatgacgccagcctcacgcccctcgagttccaaggctacaat
ctgtctgccaacaagcagtttctcctgaccaacaatggccattcagtgaagctgaacctg
ccctcggacatgcacatccagggcctccagtctcgctacagtgccacgcagctgcacctg
cactgggggaacccgaatgacccgcacggctctgagcacaccgtcagcggacagcacttc
gccgccgagctgcacattgtccattataactcagacctttatcctgacgccagcactgcc
agcaacaagtcagaaggcctcgctgtcctggctgttctcattgagatgggctccttcaat
ccgtcctatgacaagatcttcagtcaccttcaacatgtaaagtacaaaggccaggaagca
ttcgtcccgggattcaacattgaagagctgcttccggagaggaccgctgaatattaccgc
taccgggggtccctgaccacacccccttgcaaccccactgtgctctggacagttttccga
aaccccgtgcaaatttcccaggagcagctgctggctttggagacagccctgtactgcaca
cacatggacgacccttcccccagagaaatgatcaacaacttccggcaggtccagaagttc
gatgagaggctggtatacacctccttctcccaagtgcaagtctgtactgcggcaggactg
agtctgggcatcatcctctcactggccctggctggcattcttggcatctgtattgtggtg
gtggtgtccatttggcttttcagaaggaagagtatcaaaaaaggtgataacaagggagtc
atttacaagccagccaccaagatggagactgaggcccacgcttga
E
atggatggtacaagaacttcacttgacattgaagagtactcggatactgaggtacagaaa
aaccaagtactaactctggaagaatggcaagacaagtgggtgaacggcaagactgctttt
catcaggaacaaggacatcagctattaaagaagcatttagatactttccttaaaggcaag
agtggactgagggtattttttcctctttgcggaaaagcggttgagatgaaatggtttgca
gaccggggacacagtgtagttggtgtggaaatcagtgaacttgggatacaagaatttttt
acagagcagaatctttcttactcagaagaaccaatcaccgaaattcctggaaccaaagta
tttaagagttcttcggggaacatttcattgtactgttgcagtatttttgatcttcccagg
acaaatattggcaaatttgacatgatttgggatagaggagcattagttgccattaatcca
ggtgatcgcaaatgctatgcagatacaatgttttccctcctgggaaagaagtttcagtat
ctcctgtgtgttctttcttatgatccaactaaacatccaggtccaccattttatgttcca
catgctgaaattgaaaggttgtttggtaaaatatgcaatatacgttgtcttgagaaggtt
gatgcttttgaagaacgacataaaagttggggaattgactgtctttttgaaaagttatat
ctacttacagaaaagtaa
F
atggccgcgcagctggagcaatttttggtgaatgaagggcaggtcgaccagagggcggtc
acgtatatgctcaagggactgcagctcgagagcctttctgactttgcctcgttctggacg
tccaaggactatgagaacggtgttcgggatgacatcatctccaaggtcgcgcccttcaat
tcagacctctccctgcccgcagccaagctccaggttgcacggctacgcgcagcgtggcgg
aaggcacagggtaagccgtcggcagccgtccctctgcagagcgccaagcccgttgccggc
tcagtggtaacagccacgaaggacacaggcttctgcgagaaaacgggattggagtctggc
ggggttgctcatggaggcgctttgaatgcagctcaggtggcgcacctcgatgaggatgcg
ttcaagggtgggctgcacaggcccaagtttgacagcgagggcctccacaagccgcacacc
tccggcggcaagacctacgagaccggcttccactacctccttgaggcgcatgagcttgga
ggcaagaatgctgatggcggcttcggtgggcccctctgtgctgacccatttagccctgag
atcgaacagctctgccaggcgcttgtccgcgaggcacaggacgacaagacgctgtgcttc
gagaacttcaccaagccgtgcccacagctgaccaagaagcaggtcgagctgtgcaagggc
ttcgactacggcgacaagacgctcaagctgccctgcggccctctgccgtggccggccggc
ctcccggagccaggctacgtgcccaagaccaaccccctccatggccgttggattactgtc
tccggcggccaggctgcgttcatcaaggaggccatcaaagctgggatgctgggtgctgcc
gagtcccacaagatcatggcggacaccgaccaccaccagaccggcggcatgtacctgcgg
atcaaccagaatggagatgtgtgcaccgtcgacgcctccgtcgccaagtttgcccgcgcc
aagcgcacctggaagtccgggcactacttctacgagcccctcgtgtccggcggcaacctg
ctcggcgtctgggtcctgcccgaggagtaccgcaagatcggcttcttctgggagatggag
tctggccgctgcttccgcatcgagcgccgcgcgttcgagcgcaatggcttgatgatcatg
cgccaggccaccgaggttgcgggcaagatttcctttgtcttctacgtcaaggtgtccaac
gacccagagtccaagcccatccccctccagagccgcgactacaccgccttggccggcctg
gataatgtccccgacagcctgggtaatccctacacgtgcgaagccaaggacctggactac
ccgatcaagagggacacctggttggacaagaaccaggaggagatgctgaaacagcgctcc
atcgttgggaccgccttcgcgaagtgctgcgaccagggtttcgaggcgcacgacaacccc
aagggtggcgctctgaccgctgcccatgttgagtcgctgggcaaggaaaacttcaagaac
ggactgcacgcgcccaacttccacgacgacggcttgcacaagcccatggaggctgggggc
aaggtctactccactgggtttcattacctgctggaggcccacgaccttggcggcaagaac
gaggatggcggctacggtggccccttgtgcaaggacccctatggcaaggaggtgcagagc
atggtggagaatctgctagtgcaggcgaacgtcgacaccacgaacgcattcgacaatttc
aagcagccctgcccgcagctgaccaaggagcaggtggccatgtgcaagggcttcgactac
ggcgacaagacgctcaagctcccctgcggccctctgccgtggcccgctggcctcccggag
ccaggctacgtgcccaagaccaacccccttcacggccgttggatcaccgtctccggcggc
caggttgcgttcatcaaggaggccatcaaatccggaatgcttggcgctgccgaggccaag
aagattatcgcggacaccgaccaccaccagaccggcggcatgtacctgcggatcaaccag
tacggagaggtgtgcactgtcgacgcctccgtcgccaagtttgcccgcgccaagcgcacc
tggaagtccgggcactacttctacgagcccctcgtgtccggcggaaacctgctcggcgtc
tgggtcctgcctgaggagtaccgcaagatcggcttcttctgggagatggagtctggccat
tgcttccgcattgagcgccgcgccttcccttgtggtccgtacatgttcctgcgccaggcc
accgaggtcggaggcaagatatcctacgttttctacgtcaaggtgtccaacgaccccggc
tcgaagcctattccgctccagagccgcgactacacggccctggctggccaggacaacgcg
ccggacaaccttgggaaaccgtacaagtgcactgccagagatctggatgctcccacgaag
agggacggttggctcgacaccaacaagggtgccatgctggaccagcgtgaaaaggtttcc
aaggcattcgccaaggtctgtgagaaaggcttcgaggccggcgataacaagctgggcggc
gcgctcaacgccaagcatgtggagaagtatggtgacaacttcaagaatggcatgcacaag
cccgagttccatgaggacggcctgcacaagccaatggaggttggcggcaaaaagttcgaa
agcggcttccactacctcctcgagtgccatgagctcggtggcaagaacgccagcggcggc
tatggcggtccgctctgcgaggatccgtacggctcagaggtgcaagcaatgacagagaag
cttctgaaggaggcggacagcgatcgtacactctgtttcaacaacttccaggatccttgc
ccacagttgaccaaggagcaggttgcgatgtgcaagggcttcgactacggcgacaagacg
ctcaagcttccctgcggccctctgccgtggcccgctggcctcccggagccaggctatgtg
cccaagaccaaccccctccatggccgttggatcaccgtctccggcggccaggctgcgttc
atcaaagaggccatcaaatccggcatgctcggcgctgctgaggccaacaagattgttgcg
gacacagaccaccaccagaccggcggcatgtacctgcggatcaaccagttcggtgacgtg
tgcaccgtcgacgcctccgtcgccaagtttgcccgcgccaagcgcacctggaagtccggg
cactacttctacgagcccctcgtgtccggcggcaacctgctcggcgtctgggtcttgccg
gaggagtaccgtaagatcggcttcttctgggagatggagtctggccgctgcttccgcatt
gagcgccgtgccttccccgttggcccgtacacattcatgcgccaggccacggaggtcgga
ggcaagatctcgttcgtcttctacgtcaaagtgtccaacgaccccgagtccgatcctatc
ccgctccagagccgcgactacaccgcgttggctggccgggacaacgcaccgaccaacctt
ggcaagccctacccaacgcttgccaaggacctggattaccccaagaagagagacgggtgg
ctggagaagaacgagaaggagatgctccgccagcggaacattgtgtcctcgaccttccgc
tcgtga
Utvärderingsmall för inlämningsuppgiften i projektkursen i Kemisk Biologi
Inlämningsuppgift
Projektkurs
Kemisk Biologi
Student:
Baskriterier
Medelpoäng:
Kriteriets innehåll
(Max: 32poäng)
1
Inlämningsuppgiften språkligt och grafiskt
sammanhängande.
2
Adekvat ämnesmässigt djup, lagom fackspråk
Syftet och
innehållet
Kriteriets innehåll
3
Tydlig och välmotiverad Specifik Målsättning
4
Adekvat bakgrundssammanfattning
5
Hypoteser uppsatta och adresserade i planen
6
Genomtänkt metodmässigt innehåll både vad
gäller experimentella och praktiska aspekter
7
Genomförbarhet – helhetsbedömning baserat på
hela ansökan
8
Nyskapande, nytänkande, kreativitet ?!
Feedback:
Utvärderare:
1
2
3
4
1
2
3
4
Download
Random flashcards
Ölplugg

1 Cards oauth2_google_ed8be09c-94f0-4e6a-8e55-87a3b14a45db

Svenska

105 Cards Anton Piter

Create flashcards