1 - IFM - Linköpings universitet

advertisement
LINKÖPINGS UNIVERSITET
IFM-Kemi
Tentamen i Biokemi 2
NKEC14
2009-05-29, Kl: 14.00-18.00
Skriv namn på alla blad
Skriv endast en uppgift per blad
Redovisa beräkningar och motiveringar
Hjälpmedel: Miniräknare som inte får vara programmerad
Ansvarig lärare:
Magdalena Svensson, 5686 el. 0704-09 09 99
1.a) Du har en proteinextrakt innehållande 4 olika enzymer. Det är enzym B du önskar
rena fram och för vilket du dessutom har en enkel metod att bestämma aktiviteten.
Enzym A
Enzym B
Enzym C
Enzym D
pI
pI
pI
pI
5,5
5,8
7,9
8,0
Mw 22 000
Mw 43 000
Mw 19 000
Mw 44 000
Hur går du till väga för att separera dessa proteiner. Motivera val av
kromatografimetod/er, buffert/ar och elueringsbetingelser. Rita hur ett kromatogram kan
komma att se ut efter varje kromatografisteg. Indikera var i kromatogrammet respektive
protein återfinns. Ange enhet på axlarna i kromatogrammen.
6p
b) Enzym B är ett serinproteas och du studerar dess aktivitets pH-beroende. Hur förväntar
du dig att detta beroende ser ut? Motivera!
3p
c) Du tillverkar en glycinbuffert – vid vilket/vilka pH områden kommer den att fungera
som en buffert.
1p
2.a) Hur påverkas Hb´s syrebindningsförmåga i närvaro av 2,3-BPG (bifosforglycerat)?
Förklara utifrån vad du känner till om Hb struktur och egenskaper.
3p
b) Du vill karakterisera aktiva ytan hos ett monomert enzym mha en
transitionstateanalog. Vilken information om aktiva ytan kan du då erhålla? Ledning. Kan
du mäta aktivitet?
2p
c) ATCas är ett allostert enzym. Vad kännetecknar denna typ av enzymer? Ge en allmän
förklaring och en ATCas-specifik.
3p
d) Proteiner med gemensamt ursprung är homologa. Vilka kriterier använder man sig av
för att bestämma om 2 proteiner är homologa eller inte?
2p
3. Enzymet laktatdehydrogenas katalyserar följande reaktion:
NAD+ + Laktat  NADH + Pyruvat
Det har visat sig att produkten pyruvat kan verka som inhibitor mot substratet laktat. Av
den anledningen utfördes ett kinetikexperiment för att utreda inhiberingsmekanismen.
Härvid kördes 3 försöksserier med och utan inhibitorn pyruvat. (NAD+ hölls konstant på
mättnadsnivå i samtliga fall).
Laktat (mM)
1,5
2,0
3,0
10,0
Hastighet (μmol/s)
Vid 0 μM pyruvat
1,88
2,36
3,10
5,81
Hastighet (μmol/s)
Vid 40 μM pyruvat
1,05
1,34
1,88
4,19
Hastighet (μmol/s)
Vid 80 μM pyruvat
0,73
0,94
1,34
3,27
a) Beräkna Vmax.
(2p)
b) Beräkna KM.
(2p)
c) Beräkna KI.
(3p)
d) Vilken inhiberingstyp ger pyruvat upphov till enligt kinetiken och ange även ett skäl
för detta.
(3p)
4. Följande begrepp och namn är centrala inom molekylärbiologin. Ge en kortfattad
förklaring till nedanstående begrepp och namn.
a)
b)
c)
d)
e)
DNA polymeras
Semikonservativ replikation
Restriktionsenzymer
Introner
DNA ligas
(10p)
5. En vanlig teknik inom molekylärbiologin är användandet av restriktionsenzymer för
kloning och konstruktion av restriktionskartor.
a) Hur fungerar restriktionsenzymer och varför är dessa enzymer så lämpade för
kloning av DNA fragment?
(3p)
b) För analys av DNA fragment används ofta agarosgeler (Bild1) . Hur görs dessa
geler (innehåll),hur appliceras proverna (vad innehåller proverna) och hur
detekteras DNA:t?
(3p)
c) Nedanstående agarosgelen visar en plasmidpreparation (5 prover längst till
vänster) samt behandling av en plasmid med restriktionsenzymer. Hur ska man
tolka gelen, har plasmidpreparation lyckats och vad har hänt med plasmiden då
den behandlats med restriktionsenzymer? Ge en motivering till dina svar. (4p)
Bild1.
6. Nedanstående DNA sekvens visar genen för enzymet Thiopurin methyltransferase
(TPMT) . Du har fått till uppgift att klona denna gen in i en expressionsplasmid och för
att göra detta har du fått tillgång till ett cDNA bibliotek innehållande genen för TPMT.
a) Vad är ett cDNA bibliotek och vad skiljer den från ett genomiskt bibliotek?
(2p)
b) Designa primers för att med hjälp av PCR hitta genen från cDNA biblioteket
(2p)
c) I expressionsplasmider används ofta lac-operonet för att styra tillverkningen av en
viss gen. Hur fungerar lac-operonet, vilka komponenter ingår och hur kan
uttrycket av mRNa styras?
(6p)
5´-atggatggtacaagaacttcacttgacattgaagagtactcggatactgaggtacagaaa
aaccaagtactaactctggaagaatggcaagacaagtgggtgaacggcaagactgctttt
catcaggaacaaggacatcagctattaaagaagcatttagatactttccttaaaggcaag
agtggactgagggtattttttcctctttgcggaaaagcggttgagatgaaatggtttgca
gaccggggacacagtgtagttggtgtggaaatcagtgaacttgggatacaagaatttttt
acagagcagaatctttcttactcagaagaaccaatcaccgaaattcctggaaccaaagta
tttaagagttcttcggggaacatttcattgtactgttgcagtatttttgatcttcccagg
acaaatattggcaaatttgacatgatttgggatagaggagcattagttgccattaatcca
ggtgatcgcaaatgctatgcagatacaatgttttccctcctgggaaagaagtttcagtat
ctcctgtgtgttctttcttatgatccaactaaacatccaggtccaccattttatgttcca
catgctgaaattgaaaggttgtttggtaaaatatgcaatatacgttgtcttgagaaggtt
gatgcttttgaagaacgacataaaagttggggaattgactgtctttttgaaaagttatat
ctacttacagaaaagtaa-3´
Svar:
1.a) Först gelfiltreringskromatografi – enzym Boch D eluerar först troligen ej
baslinjeseparerade. Tris-buffert med pH runt 7.
Poola fraktioner med enzym B och D. Separera med jonbyteskromatografi. Vid pH 7 är B
–laddat och D + laddat. För att binda in B väljer vi en anjonbytare ekvilibrerad med exvis
Tris-buffert pH med låg jonstyrka. D kommer att rinna rakt igenom kolonnen. B elueras
genom att höja jonstyrkan på bufferten.
b) Asp bör vara deprotoniserad för att kunna dra i H från His. His drar i H från Ser – så
His bör vara deprotoniserad. His pKa normalt 6 så aktiviteten bör vara högst vid basiska
pH.
c) Glycin pKa ~^2 och ~^ 10 buffrar alltså mellan 1-3 och 9-11.
2.a) HB allostert protein. Inbindning av syre påverkar inbindning av nästa syre osv. Hb
finns in 2 former R och T, utan syre dominerar T. Ju fler syre som binder desto mer
förskjuts jmv mot R. 2,3-BPG binder till T formen och stabiliserar denna – det krävs
alltså högre halt av syre för att driva jmv. Mot R.
b) Monomert enzym ett bindningställe. Vid inbindning av TSanalog inhiberas enzymet.
För att kunna följa vad som sker måste TSanalog titreras in dvs alla E kan inte få binda
TSanalog direkt. Den information du erhåller: bindningsaffinitet – om TSanalogen liknar
det riktiga TS bör bindningaff öka.
c) Inbinding av första substratet påverkar inbindning av nästa osv. (ej MMkinetik).
ATCas katalyserar karbamoylfosfat + aspartat till N-karbamoylaspartat. ATCas binder
karbamoylfosfat först. Mätta enzymet med karbamoylfosfat. produktbildning vid olika
konc av aspartat ger en sigmoidkurva. ATCas har 6 aktiva ytor.
d) sekvenslikhet och strukturelikheter. 3D strukturen mer konservativ än aa-sekvensen.
3.a) Vmax=11,1 μmol/s
b) KM= 7,1 mM
c) KI= 40 μM
d) Eftersom linjerna med och utan I skär på y-axeln är det kompetitiv inhibering. Laktat
och pyruvat är strukturanaloger.
Download
Random flashcards
Ölplugg

1 Cards oauth2_google_ed8be09c-94f0-4e6a-8e55-87a3b14a45db

Svenska

105 Cards Anton Piter

organsik kemi

5 Cards oauth2_google_80bad7b3-612c-4f00-b9d5-910c3f3fc9ce

Multiplacation table

156 Cards Антон piter

Fysik

46 Cards oauth2_google_97f6fa87-d6cd-4ae9-bcbf-0f9c2bb34c13

Create flashcards