Namn
Personnummer
_____________________________________________________________________
DUGGA
Molekylärbiologi T3 / HT05
2005-09-23
48 p (G = 26 p)
KORTSVARSFRÅGOR (brief answer)
1. What is measured by qPCR? (1 p)
Generally, quantitative PCR measures the relative amount of DNA in a sample.
In case of cDNA (generated by reverse transcription from mRNA) qPCR = qRT-PCR
determines relative amounts of mRNA (transcripts). You can also quantify genomic
DNA by qPCR (e.g. copy numbers).
2. Beskriv kortfattad hur en microarray går till, samt vad den kan användas till!
(2 p)
See
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?CMD=search&DB=books
Principle and applications are explained in for example “Human Molecular
Genetics”
Example: DNA microarray for gene expression analysis.
Probes (a set of unlabelled cDNAs, oligonucleotides) are spotted at individual
locations on the surface of a microarray (plate/slide). Targets (usually cDNA
generated from mRNA) are labeled with fluorophores (typically Cy3-green, Cy5-red)
and hybridized with the DNA on the array (formation of probe-target heteroduplexes),
after which washing eliminates nonspecifically bound label. Specifically bound
fluorescent label is detected by a laser scanner, and the final hybridization pattern is
obtained by analyzing the signal emitted from each spot on the array using digital
imaging software which converts the signal into one of a palette of colors according to
its intensity.
Principle applications: global gene expression analysis (mRNA levels,
transcriptosome analysis), DNA variation screening, promoter arrays
3. Ge exempel på tre olika transfektionsmetoder. (1.5 p)
Cationic lipids, CaP04 , DEAE dextran , electroporation, mircroinjection
1
Namn
Personnummer
_____________________________________________________________________
DUGGA
Molekylärbiologi T3 / HT05
2005-09-23
48 p (G = 26 p)
4. What could be molecular reasons that estrogen activates transcription of gene
A in one cell-type but represses transcription of the same gene A in another celltype? (2 p)
Different coregulator (coactivators, corepressors) levels in both cell types (e.g. celltype A CoA>CoR, cell-type B CoR>CoA)
(alternative answer: different levels of the two estrogen receptors ERa/b in both cell
types)
5. What are the critical parameters of PCR? (1.5 p)
- Primer design
- Annealing temperature
- Choice of DNA polymerase
6. Why can PCR products amplified by Taq DNA polymerase, but no PCR
products amplified by Pfu DNA polymerase be used in TA cloning? (1 p)
Taq but not pfu leaves a 3’ A overhang.
7. What are some of the differences in transcription regulation between
eukaryotes and bacteria? (3 p)
Handout slide 3.
2
Namn
Personnummer
_____________________________________________________________________
DUGGA
Molekylärbiologi T3 / HT05
2005-09-23
48 p (G = 26 p)
8. What are the two ways transcription factors alter chromatin structure? (2 p)
- ATP dependent chromatin remodeling
- Histone modifications (acetylation) (HATs)
9. Why does a protein bound to DNA leave a “footprint” in a DNA footprinting
assay? (2 p)
Proteins bound to DNA protect the DNA from digestion by DNAse I, and bands of
this length will not be observed after gel electrophoresis.
10. Explain the term ”epitope tagging” and give two examples when it could be
used.
(2 p)
Recombinant DNA technology enables the insertion of specific foreign
sequences to genes of interest. When these sequences encode short
peptides they create an antigenic determinant (epitope) that can be
recognized by antibodies. Thus, when the DNA sequence of interest is
fused with the DNA sequence of the short peptide and introduced into cells,
the resulting expressed protein is now a "tagged protein." Since antibodies to
the peptide tag are commercially available, there is no need to generate
specific antibodies to identify, immunoprecipitate or immunoaffinity purify the
protein. Moreover, in most cases the stable fusion protein has the same
bioactivity and biodistribution as the native protein.
Many different epitope tags have been engineered into recombinant proteins.
These include FLAG™, HA, HIS, c-Myc, VSV-G, V5 and HSV.
Applications: Affinity-purification of protein complexes, coimmunoprecipitation, detection of protein expression in transfected cells,
determination of intracellular protein localization …
3
Namn
Personnummer
_____________________________________________________________________
DUGGA
Molekylärbiologi T3 / HT05
2005-09-23
48 p (G = 26 p)
BERÄTTARFRÅGOR (essay-type longer answer)
11. Restriction enzyme digest (6 p)
Class II restriction enzymes recognize and cleave so-called “palindrome” sequences.
The sequence below contains 6 bp recognition sequences for enzyme A and B,
resepctively. Cleavage with enzyme A (G*AATTC) produces a 4 nucleotide
5´overhang, while cleavage with enzyme B (TTGCA*A) produces a 4 nucleotide
3´overhang (*indicates the cleavage site).
5´-TCTCCAGATTGCAATTGCCACCCACAGAATTCTTGAATTCGG-3´
(A) Identify and label the recognition sequences for A and B in above sequence.
5´-TCTCCAGATTGCAATTGCCACCCACAGAATTCTTGAATTCGG-3´
B
A
A
(B) Write down the double-strand DNA sequence of the resulting insert after cleavage
with both enzymes A and B.
5´
3´
ATTGCCACCCACAG
ACGTTAACGGTGGGTGTCTTAA
3´
5´
4
Namn
Personnummer
_____________________________________________________________________
DUGGA
Molekylärbiologi T3 / HT05
2005-09-23
48 p (G = 26 p)
12, Du arbetar på ett mycket framgångsrikt bioteknik företag och har lyckats
framställa 3 nya molekyler som du misstänker kan fungera som ligander till estrogen
receptorn. Du väljer att testa dessa eventuella ligander med hjälp av mammalie tvåhybrid systemet för att avgöra vilken effekt liganderna har på receptorn. Du
transfekterar in en reporter med bindnings site för Gal4 DBD framför luciferas genen
tillsammans med estrogen receptorn och en β-galactosidas reporter för att normalisera
transfektionen. Som interaktionspartner använder du dig av en peptid med sekvensen:
SSNHQRLIELLSSSR
Efter att du skördat cellerna har du följande 5 prover:
Prov 1: behandlat med DMSO
Prov 2: behandlat med estradiol
Prov 3: behandlat med presumtiv ligand nr 1
Prov 4: behandlat med presumtiv ligand nr 2
Prov 5: behandlat med presumtiv ligand nr 3
Efter att du mätt luciferas aktiviteten samt β-galactosidas aktiviteten så får du följande
data:
Prov 1:
Prov 2:
Prov 3:
Prov 4:
Prov 5:
Luciferas:
0.1
50
30
20
0.5
β-galactosidas
0.1
0.5
5
0.2
0.2
Redogör för hur du med hjälp av detta försök kan säga om någon av
molekylerna eventuellt har förmåga att fungera som ligand till estrogen
receptorn och i såfall vilken? Går det att säga om molekylen/molekylerna
fungerar som agonister eller antagonister? (6 p)
Svar: Prov1= bakgrund normaliserad aktivitet=1
Prov2=Positiv kontroll, agonist normaliserad aktivitet=100
Prov3=Ligand1 normaliserad aktivitet=6
Prov4=Ligand 2 normaliserad aktivitet=100 troligen agonist
Prov5= Ligand 3 normaliserad aktivitet=2.5
Ligand nr 2 är effektiv att inducera en konformationsförändring liknande den som
estrogen gör, dvs sätter receptorn i en aktiv konformation, man kan därmed misstänka
att denna ligand skulle fungera som en agonist för estrogen receptorn. Ingen av de
andra liganderna åstadkommer en effektiv agonist konformation. Kan ej säga om de
fungerar som antagonister med detta försök.
5
Namn
Personnummer
_____________________________________________________________________
DUGGA
Molekylärbiologi T3 / HT05
2005-09-23
48 p (G = 26 p)
Answer THREE out of the four following questions:
13. En gen uppregleras av hormon X. Du har klonat promotorn till denna gen, ca
2000bp, framför en reportergen i ett konstrukt som kan användas för
transfektion i mammalie celler. Nu vill du ta reda på vilken sekvens i denna
promotor som fungerar som responselement till transkriptionsfaktorn hormonet
X binder till. Beskriv hur du kan gå till väga för att hitta den sekvensen. (6 p)
Den enklaste metoden är att göra deletioner av promotorn viket kan göras
genom att använda klyvningställen för restriktionsenzymer som finns I
promotorsekvensen. Om man vill åstadkomma deletioner med jämna mellanrum
tex deletera bort 100bp åt gången så är det enklast att använda PCR (designa
forward oligos med 100bp mellanrum och använd en och samma reverse oligo
till alla forward oligos. För att underlätta kloning in i reporterplasmid så kan
man introducera klyvningsställe för lämpligt restriktionsenzym.
Reporterplasmider med olika längd av promotorn transfekteras sedan in i
mammalieceller för att undersöka i vilken deletion som responselementet har
försvunnit.
Alternativa svar: Lägre poäng
Användning av ChIP assay kan ge svar på ungefär vart responselementet är
lokaliserat.
EMSA (gel-shift) bygger på att en skillnad i bindning kan observeras. En
skillnad i bindning till en DNA sekvens behöver inte betyda att detta är det
responselement som man letar efter (det finns ingen koppling till aktivering
såvida man inte muterar bindningssekvensen och därigenom förlorar aktiviteten
av promotorn)
6
Namn
Personnummer
_____________________________________________________________________
DUGGA
Molekylärbiologi T3 / HT05
2005-09-23
48 p (G = 26 p)
14. Draw the common domain structure of a typical nuclear receptor and explain
at least four functions associated with these domains (6 p)
Drawing of the typical domain structure see lecture handouts.
Conserved domains:
DBD - DNA-binding domain; promoter element = DNA recognition and binding
LBD - Ligand-binding domain; ligand binding, dimerization domain
AF-2 - Activation function 2; ligand-dependent activation domain, part of the LBD
Helix12 – flexible region of AF-2 (changes conformation)
Variable (less/non-conserved) domains:
AF-1 - Activation function 1; ligand-independent activation domain in the N-terminus
Hinge – flexible region between DBD and LBD
7
Namn
Personnummer
_____________________________________________________________________
DUGGA
Molekylärbiologi T3 / HT05
2005-09-23
48 p (G = 26 p)
15. Explain at least three different techniques to study protein-protein
interactions.
(6 p)
Name and explain three of the following techniques:
GST- pull down
SPR (surface plasmon resonance, BIAcore)
Two-hybrid system
Co-immunoprecipitation
FRET (fluorescence energy transfer)
All techniques are well explained in lecture handouts, Alberts, Current Protocols etc.
8
Namn
Personnummer
_____________________________________________________________________
DUGGA
Molekylärbiologi T3 / HT05
2005-09-23
48 p (G = 26 p)
16. The transcription factor HMaC is a ligand-dependent DNA binding protein
that regulates gene expression by binding to BRE response elements in the
promoter region of its target genes, such as NJ1. Describe how you would design
a ChIP assay to verify the recruitment of transcription factor HMaC to NJ1
using human cells, and summarize the expected results. (6 p)
Before I begin with the ChIP experiments, I would design PCR primers that would
amplify a region that contained the BRE elements in the NJ1 promoter, as well as
PCR primers that recognise a downstream sequence of the promoter (~1000 bp) (an
upstream sequence would also be fine) to ensure to check for non-specific
recruitment. I would also obtain an antibody raised against HMaC, and the ligand that
activates HMaC.
ChIP assay:
Grow cells in culture.
Treat cells with ligand ˆ including a time 0 control.
Cross-link cells with formaldehyde.
Lyse cells and shear the chromatin by sonication to an average length of 500 bp.
Immunoprecipitate the HMaC chromatin complex using the specific antibody for
HMaC and normal IgG to control for background.
Reverse cross-links.
Isolate and purify DNA.
Perform PCR with PCR primer pairs the recognize BRE site and those that recognise
the downstream sequence (an upstream sequence would also be fine) - be sure to
include total (input) samples for comparison..
Run samples on Agarose gel
PCR products will be present for both amplicons (BRE and downstream) in the
total/input samples.
No bands will be visible in the IgG samples.
No recruitment of HMaC will be seen in the time 0 to the BRE (no bands will be
visible), a strong band will be apparent in the HMaC treated with ligand samples that
were amplified with the BRE primer pairs. NO bands will be seen for HMaC
immunoprecipated samples that were amplified with the downstream primers. The
data demonstrate the ligand dependent recruitment of HMaC specifically to the BRE
sites in the NJ1 promoter.
9
