Tenta HT 2011

advertisement
TFKI09 BIOKEMI
TFKE32 BIOTEKNISK BIOKEMI
2011-12-14 kl. 14.00-18.00
 Skriv namn på alla blad.
 Skriv endast en uppgift per blad.
 Redovisa beräkningar och motiveringar.
 Hjälpmedel: Miniräknare som inte får vara programmerad och millimeterpapper.
Ansvariga lärare: Helena Herbertsson (0705-669944), Magdalena Svensson (5686),
Lars-Göran Mårtensson (5705)
LYCKA TILL!
1. a) Rita strukturen för följande tetrapeptid, Glu-Tyr-Pro-Ala vid pH 7. Rita/markera
huvudkedja, sidokedjor, Cα, N- och C-terminal. Ange även vilken nettoladdning
tetrapeptiden har vid pH 7.
(4p)
b) Du har två olika peptider, A och B, med följande sekvenser:
A: Ala-Ser-Phe-Val-Tyr-Glu-Trp-Ala-Ile
B: Gly-Phe-Ile-Leu-Lys-Thr-His-Gly-Gln
Olyckligtvis har ”någon” glömt att märka rören. Så där står du med två rör och vet inte
vilken peptid som finns i vilket rör. Ge förslag på två experiment som skulle lösa
problemet. Motivera.
(4p)
c) Vilken påverkan på disulfidbryggor i ett protein förväntar du dig vid tillsatts av urea?
Motivera.
(2p)
2. a) Du har studerat aktiviteten för ett vattenlösligt globulärt protein. Nu har du tillverkat ett
par mutanter av proteinet:
Mutant 1: En ytligt placerad Gly är utbytt mot Tyr.
Mutant 2: En till det inre av proteinet lokaliserad Ile är utbytt mot Leu.
Vilken påverkan av proteinets aktivitet förväntar du dig av dessa mutationer och varför?
(4p)
b) Du har ett proteinextrakt innehållande följande proteiner:
Karboanhydras, Mw 30 000
Hemoglobin, Mw 64 500
Antikropp IgG, Mw 167 000
Du vill nu separera dessa proteiner. Ange vilken typ av kromatografi du använder samt
rita hur ett kromatogram skulle kunna se ut efter detta reningssteg. Ange enhet på
axlarna samt indikera vilket/vilka protein som toppen/topparna representerar.
(3p)
c) Kymotrypsin är ett proteolytiskt enzym. I kymotrypsins (och många andra proteolytiska
enzymers) aktiva yta finns tre aminosyror som brukar kallas för en katalytisk triad.
Vilken reaktion är det som denna ”triad” normalt katalyserar och varför krävs det tre
aminosyror för effektiv katalys.
(3p)
3. a) Cytokrom P450 är en grupp enzymer som har en nyckelroll vid nedbrytning av
läkemedelssubstanser. De finns i många organ såsom lever, lungor och tarmar. För att få
en ny läkemedelssubstans godkänd måste läkemedelsföretaget undersöka hur substansen
metaboliseras av cytokrom P450-systemet och visa att inga skadliga metaboliter bildas.
Vid en sådan studie fann man att läkemedelskandidaten midazolam, ett lugnande medel,
metaboliserades till 1-hydroxymidazolam i tarmarna. Kinetiska data för reaktionen
sammanställdes i en tabell.
Midazolam (M)
1
2
4
8
Uppmätt hastighet (pmol/(l·min))
100
156
222
323
Hastigheten uppmättes i pmol/(l·min) där p = pico = 10-12. Beräkna vmax och KM för
reaktionen.
(6p)
b) Bilden nedan illustrerar inhibering av enzymkatalys.
A
B
i) Vilken av figurens delar illustrerar kompetitiv respektive nonkompetitiv inhibering?
Motivera.
(1p)
ii) Rita upp en schematisk Lineweaver-Burk-plot som erhålls efter ett experiment då
man mätt hastigheten för en enzymkatalyserad reaktion i frånvaro respektive närvaro av
en kompetitiv inhibitor. Ange storheterna på respektive axlar.
(2p)
iii) Vad ska man tänka på vad gäller struktur vid utveckling av ett läkemedel som ska
fungera som en kompetitiv hämmare?
(1p)
4. a) i) Vilken molekyl fungerar som kroppens energivaluta och i vilken process bildas den stora
mängden av nämnda molekyl?
(1p)
ii) Beskriv kortfattat processen då molekylen bildas.
(2p)
iii) Varför frigörs så mycket energi när nämnda molekyl hydrolyseras?
(1p)
iv) Den nämnda molekylen kan inte lagras i kroppen utan bildas först då energibehov
uppstår. Ge exempel på två molekyler vars uppgift är energilagring.
(1p)
b) Metabolismens hastighet är rigoröst kontrollerad och det främsta kontrollkriteriet är
energistatus. Vissa processer såsom glykolys, som innebär nedbrytning av glukos, och
glukoneogenes, som innebär nysyntes av glukos, sker aldrig samtidigt.
i) Vilken av dessa två processer är aktiv då [ATP] är låg? Motivera.
(1p)
ii) För att kunna genomföra kontrollen måste processerna skilja sig åt lite. Ange vilket
enzym som är viktigast för att kontrollera glykolysens hastighet och ange en reaktion
där något gör att glykolysen och glukoneogenesen skiljer sig åt (utöver att reaktionerna
sker i omvänd riktning).
(2p)
c) När fettsyror bryts ner bildas acetylCoA som sedan omvandlas till CO2 och H2O via
citronsyracykeln och den oxidativa fosforyleringen. Energi frisätts både i själva
spjälkningen av fettsyran till acetylCoA samt när acetylCoA bryts ner. Om palmitinsyra,
en fettsyra med 16 kolatomer bryts ner bildas 8 acetylCoA. Själva spjälkningen leder till
frisättning av 26 ATP. Motsvarande hur mycket ATP frigörs totalt när palmitinsyra
bryts ner? Redovisa dina beräkningar.
(2p)
5. a) Beskriv strukturen hos DNA-dubbelhelixen (beståndsdelar och sammanhållande
bindningar).
(2p)
b) i) Vad kallas processen då en exakt kopia av DNA bildas och vilka enzymer spelar
huvudrollen för den här processen?
(1p)
ii) En variant av enzymet har s k exonukleasaktivitet. Vad innebär det och varför är den
så viktig?
(1p)
c) i) 2’,3’-dideoxyinosin (se struktur nedan) används som anti-HIV-läkemedel då det
förhindrar virusförökningen. Föreslå hur läkemedlet verkar.
(1p)
ii) Virus kan innehålla enkel- eller dubbelsträngad arvsmassa. Om man fann att ett virus
innehöll 12% A, 32% G, 19% T och resten C, vad kan man då dra för slutsats om
virusets arvsmassa? Motivera.
(1p)
d) Efter transkriptionen men innan translationen processas eukaryot DNA. Vad är det som
tas bort och varför?
(1p)
e) Beskriv prokaryot translation kortfattat (lokalisering och process från start till stopp).
(2p)
f) Ange en kod för aminosyran Ala samt motsvarande antikod på en tRNA-molekyl som
ska bära denna aminosyra. Se tabell över genetiska koden på nästa sida.
(1p)
6. Du har som nyanställd molekylärbiolog fått till uppgift att klona genen för proteinet
tiopurinmetyltransferas (TPMT) (figur 1). Med hjälp av PCR vill du ”fiska” fram genen för
att sedan klona den i en expressionsvektor för att kunna uttrycka den i E.coli.
a) Hur fungerar PCR? Beskriv de olika stegen i en PCR-cykel och ange vilka
komponenter som behövs för PCR.
(4p)
b) Designa primers för att kopiera TPMT-genen.
(4p)
c) För att kunna analysera den amplifierade PCR produkten kör du en agarosgel. Hur
fungerar en agarosgel och vad förväntar du dig att se på denna gel?
(2p)
5´-atggatggtacaagaacttcacttgacattgaagagtactcggatactgaggtacagaaa
aaccaagtactaactctggaagaatggcaagacaagtgggtgaacggcaagactgctttt
catcaggaacaaggacatcagctattaaagaagcatttagatactttccttaaaggcaag
agtggactgagggtattttttcctctttgcggaaaagcggttgagatgaaatggtttgca
gaccggggacacagtgtagttggtgtggaaatcagtgaacttgggatacaagaatttttt
acagagcagaatctttcttactcagaagaaccaatcaccgaaattcctggaaccaaagta
tttaagagttcttcggggaacatttcattgtactgttgcagtatttttgatcttcccagg
acaaatattggcaaatttgacatgatttgggatagaggagcattagttgccattaatcca
ggtgatcgcaaatgctatgcagatacaatgttttccctcctgggaaagaagtttcagtat
ctcctgtgtgttctttcttatgatccaactaaacatccaggtccaccattttatgttcca
catgctgaaattgaaaggttgtttggtaaaatatgcaatatacgttgtcttgagaaggtt
gatgcttttgaagaacgacataaaagttggggaattgactgtctttttgaaaagttatat
ctacttacagaaaagtaa-3´
Figur 1: DNA-sekvens av proteinet Tiopurinmetyltransferas (TPMT).
Download
Random flashcards
Ölplugg

1 Cards oauth2_google_ed8be09c-94f0-4e6a-8e55-87a3b14a45db

Svenska

105 Cards Anton Piter

organsik kemi

5 Cards oauth2_google_80bad7b3-612c-4f00-b9d5-910c3f3fc9ce

Multiplacation table

156 Cards Антон piter

Create flashcards